Description :
From Genome Similarity Track
Location :
Scaffold_1270:184- 4515
Transcript NameFunction/comments
Pytar_ATCC12531maker-par_contig_1270-fgenesh-gene-0.0Acyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase
Pytar_ATCC12531snap_masked-par_contig_1270-abinit-gene-0.7Bos taurus similar to AHI1 protein (LOC528398), mRNA.

Sequence
4331 bases(100 bases per row)
TGCCAAAACAAGGTGGGTTACAGTTCATGGTGATATTTTCCGGTACAAATGTTGCCTGTCCCAGAGCCGTCAGTCTTTTTCCTTGGCTGTCGAAATGCTG
CTCATGCCGCCCATGCTGCGCCGCTGCCCGCTGCGGTTTCCGCAGGATGCCGCGGCGGAGGCGCTGCTTCNNNNNNNNNNNNNNNNNNNNNNNNNNCCAC
GGCCACTAGATCAAGTGCGCTGTCTTCTCGCCGTCTCGTACGTATCGCTCGCGTCACCAAACGCCTCCTATTGAGGCGGCTAGCTTCCGGAAGCTCACCG
TTGGTTTCCCCATGGACAGACGTCCGCTTCCTCTGCTGTCATGCAGTCCATGGAAGAGCTGATTGACCACGCTGCTGTACGTGCGGTCTCATACTCCCTG
TACCCATCAGGAAGGCTTCTGTAGTTATGCGGGCGTTGGCACACAGGCGGGAAAGCGCCACGAGCAGGACGCCAAGGTCTCCTCCGACAGCCACTTGCTA
GCGTCACCGTTTCTCCACACGCATCTGGACGAGAACGCCGTGGTCCACCCAACCGCCGTCGTCGATGCGAGCGCGTCGCTCGGCCGCAGCGTTCGTGTGG
GTCCCTACAGCGTCGTCGGACCGAGTACGAGTATTGATCAAAAGCGAGCGTCTTCATTGGATGACCACTGATCCGTTCGTTCTGTGTGTGCAGACGTTGT
GCTGGAGGATGGCGTTGAACTGAAGTCCCACGTTGTCGTCGAAGGCAGGACTCGCATCGGCCGGGAGACCGTGGTCCACCCGTTCGCGTGCTTGGGCGGC
GAGCCGCAGGACAAGAAGCACAACCCACACGTCGCGCCCCACTCGTCTTCGTTATTCCAGCTGGAAATCGGTCGCCAGTGTGTCATTCGTGAGCACGTGA
CGATTCACGGAAGCACGTCCTACTCGGCCGCCATGCCGACGTCGCTGGGCGATAACTGCTGGATCTTGTGCGGCGCCCACGTGGGCCACGACGTTCAAAT
TGGAAGCCACGTCGTGCTATCCAACAATGTCTGTGTCGCGGGACACGTGGAGATTGGCAGCTTTGCTATTATCGGTGGCCTGGTCGGACTTAAGCAGCAC
ATCAAGATTGGCAGCCTCGCGATGGTTGGTGGAGGCAGCGCGGTCGACGGCGATGTGCTTCCGTACGGCCTGGCCAGCGGCAATCGTGCCAAGCTACTAG
GTCTCAACCTCATCGGCCTTCGACGAGCCAAGATTTCTCGCCACCAGATCAAGCTCATGCTGCGAGTCGTGCGTTATCTCTTTGGCTCATCATTGACGAA
TATTGCTGCTGTGTGCCCGAAGACGGGATTTGCCCCTGCACTCGAGTACGCCTGTATGGTCCATATCCACTGATCTGACTGACCCGAACTGACAACACGC
GTTTGTTTGCGACCTCGCAGTCTCCCGCACCACGACTCGGTTCTTTTGCGAGCGTTCGAGGCCAAGCGATATCTTGCTGACCTCGAGATTACTCTCGAGG
GTAATCCGTTTGTCCACGAAATTGTATGTGTTCAAGATATGGGTGATGCTGGTGATCTCTCTGATCTTGACGCTCATGCTTTCTGTCGTAGGTCGACTTT
GTGCTGCACTCCCCGGATCGTCCGAAGTCAACGCTATGCAATGCGCTCCTGCATTGATGATGCCATTTTCGACCCATGGTACAATAAACGGCTATTCGTG
AAACCAGAATACATATATCCACATAGAGTCTCGGAGCAAATCTATCTGGAGAAGCTCGCGACTGTTGGTGGTGCCGGTTGACATCTGATCGTTGTTCGGC
GTTGATGATGGCAAGGAGCATTGAAGATCCGAATGAAGGGCACCAGCATGACGACAGAGATCAGCATGCTTTACCAGAGGCAGAGGCGCTTTTGAGCTTG
CAGCATCCGCCACCAATTGATGGAGTTCCCAACGCAGAAACTGCTGCAGTGTCGTCTTCTCCACTCCTCGTCCGGCCTGACAATGATCCGAGCACGAAAC
CTGACAAGTTGAAGCAAATGAAGCCGAAGAAATCTCGAAAGGCGTCCGGGTCTGGAGACCTCCGCGCACCACGTCCAAGATCGAAGAAACGCGATTCGAA
GGATGGGCCCACAAATCGCTCTGGTCAAGCAAGGGGTGATCTGAAGAGTGGAGATGTTCCATCACAAATTCAAGATCAATCCTACACGCAGCGTGCGCCG
CGACCGGCCTCGAGTTGTTGTTCCGTGTGGAGCTTGTTCAGTCGCTGCATCTGCGTCAAAGGATCTTTGCTGCCGCCCGTGAGTGTGACAGAACTCTCGC
CATTGTCAGCGCAAGCGAAAATGAGGTTGAAGTCTCTCGACAAAATATCAAGAAAATGCCAGGTGGAAGTGTCTGTACGCCATACCGACAGTATGTCGTT
GTCGACCAACAGCATCACCAGCTACGGGCATCCGATCGTGGTCATCAACGTTGTCGACGTGTTGACGGGGCTTTCACTGGCGACGCATCAGCATACACGA
CCAGCGATATTCAGTCCAAAAATGCTCAACGCGTTTGAATGGAACTCGGCCCACACCTGGCCGAAACTGACTCTGACCGAGTTTCTTTTACCCCAAGTCG
TCGTTCTGCTGGAGATTATTGAGCCGAGGCAACGAAGCCTTCCTCGACGACCATCAAGTTCAGCGCCAAAGCGGCAAGATTTGAGCAGCACAAAACGCAC
CACCGCCAACTCCAAGGGCATCCTTTACGATTTGAAGAGCGAGAGGTTCTATCGACGCATCGCATGGTGTTTCTTCAAGCCGATCAATGCACGTGGAAAC
ATTCGACTTCCGCTTTCTATGCTAGACGATGCGAGCGAGCGTGATGACGCAACCTTGCGGCTGCAGCTGTATGCGTGGTTGCCTCTGAGCTGGCTGGACG
CGCACCAAGCCCGATCGCAATTCCAGTGGACTCCTGAGTCTGGTGATGGCGTGCCGACAGTGTTCCTGCAGTACCAACGACGCACTCGGACGCAACTACC
GTGCACTCTTCACGTTGAGATCCGACCTGTGGCGGCAAGAAACCCTCCAACGCAATCTGAAAGTATTCCTGAGGGTGTATCGGATACAACGGCAAAGGGG
ATACAAGGTCCCACCGAAAGTAACCCAAACGGGACTGTCGATCAGCCTATTGTCCAACCAAGCGCAGAGAGTGTGGCAGAAGCCGCCTACAGCGCTCCCG
GTCCGTTGCTGCTTTGCAAGCGCAATATCGGTGAACCTTGCTTGGTTCCGCGACGCGTGTTACATCGCCTCCCAACAGGACGCAGAGGCTGCTCGTGCTT
GGCATTCAGCCCCGACGGACTCTTCATTGCCGCTGGTGTTCACCATGCCACCTCCACTGCCGACGAATGGGTCGTCCAGATTCACGAGATCAACACGGGC
GAACTCTGGCAGAGCTGTCGTGGCCACCAGGGCATGGTATACGCGGTAGAGTGGGGGCTTCTGGTGGATGGAAGCACTAAGGCTTTGCTTTCGACATCCT
CTGACGGAGCCGCCATCCAGTGGGGACTGATAGTACGCGGTGCTTCCAACTCACTGGAGCGAAGCAACGCACCCGTCGTACTGCCAAGCCGGACTTTCCA
GCACGTTCCGTCACCGGTCTTTGTCTACTGCACCATCTTCCACACGACGCAGCCGCAGCTCATCGTGACAGGCGCCTCCGACGGTGCCGTTCGATTATGG
GACGCATCCTCCTCCACCATTTCGAATCGAACTTGCATGTCTACTCCAGTCCTCGAGTGGAAGATCGTTGGTGGGCAGGGCCAATCTGTCGCAGTCCACA
GCATTCGCATGGAGGCAAAGCACAACGGTCGACTCTTCTGCGGCGACTCAAGCGGGACAATTACCGTGTGGGTGCCCGCAATGTCTTGCGCTGGGACACC
AAGCTATGAGCTGAGCAAGACTGTGCGCACGGGGCAGCGCAGCATTGCGAGTCTGGCGTTGCACCCGCGCAAACAGCACTTGGTCGTTTTGACGCACCCG
CACGCACTGTTCCAGTACGAGACGCGCAGCTTTCTGCTTCTCCACAAGAACTACTCGGGTGTAGAATGCGACCAGCTTTTGGCCAAGGCAGCCTTCTCTC
CGGACGGCCAGTTTCTGGTGAGCGGGTCGGAGGACGGTGTGCCCCACCTCTTTCAAGCAGTCGAAGGAGTTCGTCTTGACGGCTCGTCCGGAGGAGGTCT
CTGGGGCCATCGCTTCTTCCATGGCTTCCCGCTGTTGGAGATTGCGTGGAGTCCAACCTCCCATGTCGTTGCGATGGGCGCGTACGGAGCAAATCACCCG
ATCGTCGTTCTGTGCGCAAACCGCTGCGATG