Description :
From Genome Similarity Track
Location :
Scaffold_925:184- 1359
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_925-snap-gene-0.4Acyl-[acyl-carrier-protein]-UDP-N-acetylglucosamine O-acyltransferase

Sequence
1175 bases(100 bases per row)
GATAATCGCGGCTCAGCGCCATGGATCCATCCGACAGCCATCGTGCATCCGGACGCGGTGATCGGTCACAATGCGCACATTGGTCCCTATAGTATCATCG
GACCAGGTGCGTGGTCACAAACAGAGCCATTTAGTTGTAACTGTCGCTCTAACTCGCGGTTGCTTCTTGCATTCTCTAGACGTGGAGCTGGAGGATGGCG
TGTTCCTGCAGGCGCATGTCGTCGTCGAGGGCAAGACGCGGATCGGACGNNNNNNNNNNNNNNNNNNNNNNNNNNNCACAGTTATCCACCCGTTTGCGTG
CATCGGTGGTGAGCCGCAGGACAAGAAGCATGCGCGTCAGGGCTCTAACAGTAGCTCCTCGACCTCTTCGCTCGTCATCGGCGACAACTGCATCATCCGC
GAGCACGTAACGATCCACGGGAGCACGTCGTATACTTTGGACACACCGACGACTGTGGGCAACGACTGCTGGATCCTGTGTGGTGCGCATATCGGCCACG
ACTGCAGCGTCGGCAATCGCGTCGTGCTCTCCAACAACGTGTGCGTCGCTGGTCACGTCGAGATTGGCGACTTTGCGATCATCGGTGGTCAAGTCGGACT
CAAGCAGCACATCAAGATCGGCACTCTCGCGATGATTGGTGGCAAAAGCGCGGTTGACGGTGACGTGCTGCCGTATGGGCTGGCGATCGGCAACCGCGCC
AAGATCGCAGGACTCAACCTGATTGGACTCCGGCGCACCAAGGTCTCGCGACAGGACATCAAGCTGATGCTGCGCATGTACCGGTATATGTTTGGCGTGC
CCAGCTGCAACAAGACTGCGTTCGCGCCTGCACTAGAGTACGCCCATGTTTATCGCATTTTCTGCTGCTTAACTCTCGGAGTTCAACATCTAATACGGTG
TCTGTTTGATGCACATACGCAGCTTGGCTGCAAGAGAATCGATCGTGCTGCGCGCCGAAGAAGTGAAAACGTACTTGCTGGACCAGCAAGTTGATTCGGA
AAACCATCCCATGGTTCACGAAATGGTATGTAAGCCTGTATATTTCATGCGGCTTTCATAATGCGCGCGATTAGGTGCAAAACCGTTTTCAACGTGGAAT
GTATGTGTGTGCATATGTTCAGGTGGACTTTGTGTTGGATTCTCCAAACCGTTTTCGATCGTCCATGTGCGCTGC