Description :
From Genome Similarity Track
Location :
Scaffold_96:183950- 185779
Transcript NameFunction/comments
Physo_141281reverse transcriptase

Sequence
1829 bases(100 bases per row)
CGGGGCGTGTTCCCACCACCGACGCCTCCGATCCGCGACGTCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAAGGA
AGCGGCAGCCGGTTCGTTATCGTATTCGTTGGAGAGGGTTTCCGCCCCACCAAGATACATGGGAGCCACGGGACGCCCTGCTGCAGGACGTTCCGGAAAT
GGTGAGGGAGTACGAAGCTCACCACGCACTGCCGACGCGAAGGTAGTGCGAGCGCTGTGGTCACCTACAGCGCCCGAGGCCCCACGATCGTCGCGTTCCT
CACGTGCCAAGAACTTGGCACGGAGATCCTTGAGACTCGCAGGTACACGAATCGTCGTGTACCCGTTTAGGTCGCGGTCGCTCAAGCACGCCGCACCCGG
AAGATACAACGTGCACTGTTGGCCTTCGGGCACAGCGCATGGAATACCAGTGTCCACAGAAGATCTGTGGAGCTGCTCCAACCTCCCGCGCGTCGAGAAT
GTCTCGAAGCGTTCACGGGCGTGCTTAACCCGCTCACGGTAAGCAGCCGGCTTCTTGTTGAAGTTCTCAACAAAAGCATTCCAACTTTGACAAAGTGCCT
GCCACTCAGGCACTTTGCTGCGAGAAGAGGTCTTCTTGCTGGAGAAGTATCGGAGCTCGTGAAAGAGTCCGATATAGTAATCGCGCCTTTGATTCGTTAA
CGGATCAAAGTGCTGCTCCTCCGCCACAGCATCATCGTGGATCCCGCTGCATACGTACAGCGGGATTTCGTTTGGAGGCACAGTGTTGCCCACACGGTCT
GCGATCTCTGACGTAGACGGCATCCACGGATCGCGCGCTGCCTGAGCAGCGCGCGGAGAACTTGAAGACGCCACCTCACGCGGGGAGCTTAAAGCCTCAG
CAGCGGAGAGCGAAGTTTCGCTCTCGCCGCGCGAACGCTTCGAGCTCGAAGCGTCCGAGTCGTCTCTTTCACGAGGGCGTCTCGACCCGGCATGCGGGTC
TAGACTATCGCTGTCGATAGACTCCTTGCGCTTGCTAGAAGAGGCCTCGCCCTCTTCCATCTCCAAACTACGTCGTCACTCCCATAGTCAACGGCGTCGT
TGACTACAGAGGAACCTTCGAGGACAATCTCCGACTGAGTTGTCCCCGACGCGGCCTTAACAGCGAGCGCGTCGCGCTTTGCCTGCTGGCGCTCATGGTA
CTGAGCAACAGAGAGATGACCCTCTGTTGCGGCGGTAGTCTTCTTCTGCGGCGAGCTCATTGCGGAATGAGCTCGAGTTTTCTTTCTCCCAACGTGAAGA
ATTGACGAATGGTCAATTTCCTGATTGGCGTGCCGTGACTCGGCGCGTCTAACCTTGAGGGGGGGATGGTGTGACAGGGTTACACGCACAAGTGGCTACA
GTCACTTGTAACTCTAACAGACACGACGTCTGTTAGAGATTCGAAAGACTTTCTCGACCTTGGTGTAGACACACCAAATGCTACATACATTTACGACCAC
CACGACGGGTGGTCCATAGAGACTTAGGATTCCTATTGGCTGAGAGCAGCATCTCTTAGCCAATGAGCGACATGCATAGCATTGGAATTCTGCCAACCAG
CCGTTGGCAGATTCCTATCTTAGAATATTACATTTAGAGGAAGTCAGAAACATAAAACAAAAATAGCAGTTCTCATTTTAACCCAAAACATTATTTGGAT
CGTTTATTTAGATTAATCTATACTCGGAGGCCCGAGTATAATTAACTCTAAGGTAAACTAAGCTACGCTTCTTCACATACCCGCGCACACGTGTAAGCTA
AAGTAGTGAGCCAAAGTAGGCCCATTACA