Description :
From Genome Similarity Track
Location :
Scaffold_397:1839- 5055
Sequence
3216 bases(100 bases per row)
AACGCTTGGAAAAACTTCGCTCATGAAGCGTGGGTCGCGGTCGTGCCATATTAACGATGGGGCTCCGAACCGTCGGTATACACATTCTTCGAGCACTTGG
GCAACACTCAGCGCAGTCGTATCCGACATAGCTTTGGCGATAACGAATCTCGTGAACGAGCACTGAAATAGGAGCAACGCCGTGTTGCCCCTGCGAGATT
TCGGTAGTGGGATCACAAAATTCATCGAGACGATCTGGAAAGGGCGTTCGGCTAGAACGTTGCCGGGTGAGTATCCACGAAGCTGCGGACGGCTTTTACT
CGAGCTGCAATCTGGACATGACTTCACATGTTTCTCCACGTCAGCGTACAAGCCGATCCAATAATAATCGGACTTAACGCGATGGAACGTTCTCACCATC
CTCCTTCCAGCGAGTCGTGACAGTTCTGCAAGACCTCTTGCATCATCGTTGTCGGTACCAGCCGCAGCTGGGTCTCTACTTGCCAACCGTGGTCGTACCG
ACGATTCAATCCAAGAAAGTGAAACACGCCGTCTTCTGATAGCACGAATCGGTCAGCGTACTTCCAAGCATCTCGAGCTTCTTTGTAACTCAGCTCTTTT
GCTTTGCCTTGAAGCACCTTCTTGATGTTAAACCACTTCTGCTCCTCGTCTTGTGCCACCAGTATCCGTCTGCGTCGTTCCCGCTGTATCGCTACCGGGT
CAACATCTTCCGCATTGGGAAATACCGCTGATACAGTCTTGTGAGGATGGTCTGGCAAATCTTTGCCGATTGAATCTTCGGTGGACGTCTCTCGTCGTTC
TTCATGCTGTTCTGTGCCTTTGATACATCCTCCGAGTGTTCATCTGCAAACCTGACGTGATTCTTGGCGTTCGTCTGTCGCCGAGTCATCACTGCCATAT
TACCATAATTGCACTCTGGTGAGCCGTAATCAACCACGAAATTTTCAAAAGTTTGAAGACTCGCTGCCTGACAGTACATGTACTTGACACTCTGCTCCAC
GTGACGAAACATCTACCGAGTCTATATCCGGCTCGTAGATCATTTCCTGGATGCGATTCAGCGACGCCAATTCCGACTTGCGAGTTTCAGCCAGGATGAC
CCGACTGACCTTCGATTCTAGCTTCAGTGGCTAACGAATCCGCGGCAGCGTTGTATTCTCGTACAACGTGGAGATATTTAACTGATCGAAGCTTGGCCGT
GAGTTCCTTGTAAGTATTCAGCAGCGCTAGCAAAGTTTCCTTCCTGCATGCGATCACCCCTAGTGATTGTTGAATCGCGAGCCTTGAGTCACCAACGATG
ACTAAATCCTCGGCACCGTGCGCAATAGCAGCCTTGACACCGCTAATCATTCCTGTGTACTCTGCCTCATTCACCGTGGTGGCCGAGAGGTAAGCGTTTG
CAGCAATCACTACCTTCCACTCAGGAAGGCTCCACAGCACCCATGAACAACTCCCGTAGCCACCGTACTTCTCTGTCTTCGCTGATCCGTCAAAAGACAT
GACGAATCCGCTGTAATTACGGGGAAGCCTGGCGTACAGCAACGCGGGGTCCATTCGAATAGTCGGGGAACCCTTGTTTGGAGGTGCCACCGGCGCGAGC
GAGTCTTCCAGGTCGACGAAGCTCGTGATGCTTGACTGCAGTAGCTGCGCGAAGGCGACATCCTTCTCCTTCACGCGCTGCACCTTCAGGTGCCACTGCG
ATAGCAGCACTGCGAACTGGACCGCACGTCCGCAGAGAGACTTCGTCTTATGCACCCACTCTAACGTCGACAATCGTGTATAGGCATGTAGTGTCTTTCC
TGCCAGCTGGACGTAACAGATCTTCAACAGCAGAAGTAACGCCAAAACTTCCTTCTCGGCAGGATGGTAGTTTATCTCGGCCTCCTTGAGCACCCGACCG
AGGAACCGTACGGGGTGTAACTTGCCTTCATGTTCTTGCATTAGCGTAGTGCTCAACGCCCATTCATTCGCAAAGAGCATGACGTGAACTGCTTTCGACC
GATCGAAGTGCCTGAGGATGGGTTAATGTGAAACACTCGTCTTCCATTTTTCGAAGGAACGACGTGCCACAGAAAGGCCACCTTCAACGGCAAAGTCTTC
ATCCTTAAGCAGGTACAGCGCCGCACCGTAGACCGCGAAGTCTTAAATGAAGCGGCTGTAGTAATTAACCGCTCCAAGAAACGACTGCATGGCCTTCTTA
CTCGTTGGAAACGAAAGCTCGGTGATGGCCGCAAGCTTCTTGGGGTCAGCCCTGATACCTTCTGGCGAAATTTTATGCGACAGAAAGTCCACCTTGGGCT
GGCAGAAGATGCTCTTGGTGAAGCTAATGCTGATCCGACCCTGTGCAAATCTTGCCAGCAATCGGTCCAGCGTCGCCAGGCAGCTGTCGAAATCCTCGCC
ACCGAAGCAGATGTCATCCACAAACGACCGTCGACCAAACGCGGGTACCAGCGATGATTCGTCCGGTTCCCCGTTCGTAAACATGTCAGCGACGGGGATG
TTGACGAGTTGTAGTACAGGGTCGGTCTCTACCGGTGCTTCGCGGTCTGCCGCAGACTTCGTTTGAAACGAACCCTCGGAGCTTGGCCCACGACGTTCCT
TGGCCTGTTCTTCAGCTAAACGCATCTTCTCCGAGTATTCAAACCAACCTCCTTTAGGTTGAGCGAACCCCCAGAGTGCGTCGTCAATCATACGCTGGCA
GATCATCGGCGCGACTTTAATCCAAAGGGCATGCGCAACCACGCGAAGTGTCCGAGTGCGCAGACAAACGCCAACACTTTTCGTGCTCGCAAGGTCATCA
TGACCGCCCAGAAGCCGCTTGGTACATCCAGCGAGCAGAACCATAGGTGGCGCTCGAGATCTGTTAACAGGTCGTCGACTAGCGGCATTGCATACTCCAT
GATCGCGGTGATAGCATTCACCATCTTGTAATCAATGCAGAGCCGGATGTCCAGCCCGTTCTTTTTGATCACAATCACGATCGGCGATGCCAATGAACTG
TCTGAAAAGACGATTAGCCCAGCTCGCAACAAAGCGCGCAGCAGCTCGTACAGTTTGCCGAGAAATCGTAGCGGCACGCGCCGGGCACGCTGTATAATTG
GGGTGTGCCCTTGTGTGTCGATATCGCATACCGCGCCGTAGGCTGGCGGCGGCAGCGCGTTACCACTAGCAATCAGGATCTGCTCGTGGTTCTTCAGCGT
CGCGACCAGACGTTCT