Description :
From Genome Similarity Track
Location :
Scaffold_652:1839- 3253
Sequence
1414 bases(100 bases per row)
TTTGGAAGCCACAGGTCGGTGGTTCAAATCCACCCGGGCGCAGCCCTCTCATACCATGAGTAGTCCGTTCTCGGACTGGCGTACGGGCATCGCCCTTATA
GCTCAATGGTAGAGCTCCGGCCTGTCAAGCCAAAGGCCAGTGGTTCGATCCCCGTCCGGGACACCACTTTCGCTGTTACAGCGCATCCACATTTGGATCA
TGCTCATCGAGCAAGTTGTTTCAATTCAACTATGCGTCTATCGAGACGATTGTGCCTGAACCTTGTTCAGCACAACACGAAGCACCTGCTTCCTTCGGGA
CCATGTCCCTAACACTACGAGGTCTCTTCACCTCCTGCTCCCGCTGCGAGCACCGCTCATACGTACGAGCTGGCTGCTGCAGCCACTGGTCAAAGCCTGA
GCTCAGCTACTGACCTGATCGCTCCCCACTCTAGTGGGAGGCGCCCAGCGCCTGGCGACGCTGTCGCACGCCATGGTGGCGCTTCGGCACATGAATGTGC
CCGGTCGTAAGCCGTCAACGACGTCGGGCAATCTTTGCCGGAAGGATAACCTCAAACTCCCATGAAGTTCTGTGAGCGAGGGGAACCTCCTCCACTTCNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCT
GGCGTCTACGCCACGCCACAAGGCATTCCACGTGAAAGTATAGCTCACCATGCTCATCGAGCAGAGCAGGAGGAGGCCTTGCCTCAGCTGGGCTCTCGCG
GGGAGAGTCAGAACTTGCCGGAACGATGTCTGCGTCCATACGAAGCCGGCGTCCACGACGCGAACGTTCACGGTCACCGCCCATCGGTCGATCTCGAAGA
GATGTTCCACCTTGTGGATAGGTTAGAGCCACCACTGTTGACTCACAACCAGGTCTCGGCCCTTGGGCGTCCAGTCGCCCGGCTGAACGTTCAGCTTGTC
TTGCTCCTGCATCTCGAGCACTTCGCCCCGCGACCTGTGACTCTGCCACATGCTGTCGTTCAGCCTCTCGTGGCTTTACCACCTGCTGCCCTGCAGCTGT
CCGTGGCCCAGCCACCGTTGGCGCCAACGCCTCCGCGCTCACCTGAGCAGGGTCTTGGTATGGCTTAAGCAAGCCAACATAGAAGACCGGATGCGTGCGC
ATCTTCTTCGGAAGGTTGAGCGTATACGTTAGGCCCTTCCTGGCCACGACCATGAACGGTCCTATGAACCAAGGTCTTGAAGACTGCAGACACTGCATGA
GTAGGTAGGTTTTTAGCGTTTAATAAAACTTGGTCACCGACCTCAAACCTCTCAACATTGCTTCTGCCCTTGGCATCTGCATGTTCCTTCTGCGTGTCTT
GGCTTTCAGCCATA