Description :
From Genome Similarity Track
Location :
contig_7:183890- 185112
Transcript NameFunction/comments
g2490.t1XP_009532405.1 hypothetical protein PHYSODRAFT_336537 [Phytophthora sojae

Sequence
1222 bases(100 bases per row)
TGGGCCAAAGTTACCTACAAGCTGAAGCGGGCGCCAGCTCAAACAATCATTTCCGACATCCCCAAGATGGCCCCGACAATCATGAGCAAGGCGTATGGGG
ACGGCAAGCGGCGCAAACCGCTGAAGGAGACCTCTGAGGCGCTGGAAGAGCGCCTATGGGAGTGGATACAGAAAGCAGAGGCGCTGAACGTGTGTCTTTC
TCGGGAGCTGATCAAAATGAAAGCGCGAGATTTACAAAAAAGAGCTATGTGATGCTTGGAAGCTGTCCTTTTCGGACGGGTGGCTCACTGCGTTCGAGCA
CAGGCATGGTCTTCGCTCTCGCTCACGACCTGGAGAAGCTGCATCGATCGACCCTGAAGTCGTTCGCGTTGGCCTTAAACGGCTTCAGGAATTGACGGAT
CTATACTCTCCCGAAGACGTCTACAATATGGACGAGACGAGGCTGTGCTACGCAATGGCCCCCGCTCGATCGATCTGCACAAAGACAGCGCGTGGTGTGA
AGAAGAAGAAGACGCGGATTACTCTCACGCTTACGGCATATGCTGATGGATCCGACACGCTGCCGGCACTCTTTTTTGGTCACGCAAAGCAGCCCTACTG
TTTCAACAAAGCACGGCGGCACAACTAGGCTTCTTGTATCGCTCGAACAAGAAAGCCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGG
ATCGCGACATGCTCGCGAAGGGCCGTCAGATCCTATTGCTGCTTGACAACGCATCGTCCCACCATTTAGGCGATATCGTGTGTACTAACGTCCGCGTAGA
GTTCCTGCCACCGAATACCACGGCATTCCTACAACCCATGGACGGAGGAATCATCGCCGCGTTCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTTGGGCG
TACGAGAAGGTCAAGCGTGGTGAAGAGCTAAAGAAGGACGTTTACACTGTCGACCAGCTACAGGCAATGCAATGGAGCAAGGAGATCTGGCTCGAACTGC
GAGGTAAGCCCACCATTCAAGACTGTTTCCACCACACTGGAATAGTGTTTAATGCTGTAGCTGAGAGGGACAAGGAGGACACTAGCTATGGAACCGACGT
TGATCTGGAGGATATCATCATTTGAGCTTCACAGTTGAGTATTTAAGTAGCCGACGATAATGCATAGCAAATCTTAGAATATGGTCGGACCACGATACCG
GAGGTGGGAGCATATGCTGTAC