Description :
From Genome Similarity Track
Location :
contig_7:183880- 185100
Transcript NameFunction/comments
g2345.t1hypothetical protein

Sequence
1220 bases(100 bases per row)
TGGGCCAAAGTTACCTACAAGCTGAAGCGGGCGCCAGCTCAAACAATCATTTCCGACATCCCCAAGATGGCCCCGACAATCATGAGCAAGGCGTATGGGG
ACGGCAAGCGGCGCAAACCGCTGAAGGTGACCTCGGAGGCGCTGGAAGAGCGCCTATGGGAGTGGATACAGAAAGTAGAGGCGCAGAACGTGTGTCTTTC
TCGGGAGCTGATCAAAATGAAAACGCGAGATTTACAAAAGGAGCTATGTGATGCTTGGGAGCTGTTCTTTTCGGACGGGTGGCCCACTGCGTTCGAGCGC
AGGCATGGTCTTCGTTCTCGCTCGCGACCTGGAGAAGCTGCATCGGTCGACCCTGAAGTCGTTGGCGTTGGTCTTCAACGGCTTCAGGAATTGACGGACC
TATACTCTCCCGAAGACGTCTACAATATGGACGAGACGGGGCTGTGCTACGCAATGGCCCCCGCTCGATCGATCTGCACAAAGACAGCGCGTGGTGTGAA
GAAAAAGAAGACGCGGATTACTCTCGCGCTTACGGCAATGCTGATGGATCCGACACGCTGCCGGCACTCTTTTTTGGTCACGCAAAGCAGCCCTACTGTT
TCAACAAAGCACGGCGGCACAACTAGGCTTCTTGTATCGCTCGAACAAGAAAGCCTGGATGACAGGACTACTGTTCCGGGAGTGGCTTCTCGATCTGGAT
CGCGACATGCTCGCGAAGGGCCGTCAGATCCTATTGCTGCTTGACAACGCATCGTCCCACCATTTAGGCGATATCGTGTGTACTAACGTCCGCGTAGAGT
TCCTGCCGCCGAATACCACGGCATTCCTACAACCCATGGACGCAGGAATCATCGCCGCGTTCAAGCGCGCGTACAGGGGAAAGCAGCTTCGTTGGGCGTA
CGAGAAGGTCAAGCGCGGTGAAGAGCTAAAGAAGGACGTTTACACTGTCGACCAGCTACAGGCAATGCAATGGAGCAAGGAGATCTGGCTCGAACTGCGA
GGTAAGCCCACCATTCAAGACTGTTTCCACCACACTGGAATAGTGTTTAATGCTGTAGCTGAGAGGGACAAGGAGGACACTAGCTATGGAACCGACGTTG
ATCTGGAGGATATCATCATTTGAGCTTCACAGTTGAGTATTTAAGTAGCCGACGATAATGCATAGCAAATCTTAGAATATGGTCGGACCACGATACCGGA
GGTGGGAGCATATGCTGTAC