Description :
From Genome Similarity Track
Location :
Scaffold_208:18388- 24513
Transcript NameFunction/comments
Physo_144602reverse transcriptase
Physo_125156reverse transcriptase

Sequence
6125 bases(100 bases per row)
GATGTCGCCATGGAGTCGGTCAGGTCGCGTTCTTCGACGAGGTCCAGAACTCGACGCAACGCAGACGAGGACCCCGATGACCTGTTCGACTTGGACATCG
GAGTGCCAAGAACCGTGGCCACCGTCTCGACGGCGACAGCCGGCGGCGTAGCCCTCGCCCGCGTACACCTCTCAGCATCTTCCGAGCTGAAAGAGTTCTC
GGGACGGGACGCCAGCGAAGAGAAAGCCAGACTGTGGCTCAACCATCGGAAGTCCGCCGCGCGGCGCGACGGGATGACGGGCGAAGAAGTGTGCGGGCAG
TTCAGCGATCTAATGAGCGGCCCTGCGCGCCAATGGTATCTCCAGTTGCCCAGGAAGGTCAAGAAATCATGGACCGAGCTGATGGAGCAATTGCGTGTGC
AGTACTGCAGTAAGGGCGTGTCAATGGCCAGCCGCTACTACCATGCGGCTCAGCGCCCCCGACGAGACCCCTCTGGATTACTTGTACCGGCTCAACGTCG
CGGGTTTGAGGGCCAACATCCCATACACCGAGGGTACGACTGAACAGAAGGGCGAAAACGTCGAGCATTTCATCCGGACGCTGAGCACGCAGGAGACCGA
ACTCGCCTCGCGTCTCACGCTGATGGAGGTCGCCGACTCCGAGGCGCTGGAGAAGAAACTGCGTGCCCGACAACGGGGACTGGCCCACCAGAAAAAGACT
CTCTTCGGCTCGAACAAGTTCCGCCAAAAGTAGCCGACCCCACCGACTCAGCCGGCGCGCGCCGTGCATGCGATTCACGTCGCGTCGGACGAGTACGACT
CGGGACGCGAAAGTCGCGACAGCGACGATCGCCAGTACGACCAAGACGAGGCGGACGAAGAACGCGCCAAGTTGTTCGTCGCGGGACAGGCCCCGCCGGG
AGAGCCGGCGCGTCGCAACTTCGATCCCGACGACTTGGGACGCGACCGCCCGCGGTGCCGCTACTGTGGTTCACGTCGCCATGTCGAAGGAGACTGCTGG
AAGTTGTTGACGTGTCAGAAGTGTGGTGGCCAGCACCCGACGGAGCGATGCTTGAGGGTGTGCAAGGCCTGCGGTGACGTGCACGAAGCAGGAGAATGCC
CGATGGAGGAGTTCTTCAGCCAATTGCGCCAGTGGTTTGACCCGAATAAACACGCGGGAATGCTGCTGCCGGCCGCCGAGAAGATGTCAAACTAGGACGC
TCGCTGGCTTGGAAACCAGTACGAGACGAGCGACCTGTTTCCGTCTATGCATATGTGACCAAGAAGTCGCGAGAGGTGGTTAGTGAGAACCCGACTTCCC
TGAATGATAATACATGTGAATTCAACCTGGAACGTGCCACGCAAGAACGCGCGCGGCGAATCTCGGCGGTCCGATGTACGACGCACGTCGAGTTTGCACG
TGAACCTCCCCTGGACGAGATCGAATTGCAACCAGGAGAGCGACGCGGATACTGGAAACATTACTCGCCGCACAAGTGGTACAAGCAGGCCAAGATTCAT
GGAACGCTGAACAACCGCCGTGCTGTGTTATTGCTCGACACAGGCGCCGAGGTGTCCATCCTGGACACCACCTTTGCTCGTGAGGAAGGCTGCCTGATCG
ACACGGAGATCACGCAAGAGTGTGTGGGAATTCGTGATGAGACATATTACACGGTGGGGAGAACCAGAGTCAAGATTACCTTGGCTGGAAACTTGGTGGA
CTACATGCACCTGTGGGTCGGCGACTTGGTCGGCCAACACACAATCCTCGGAATGAACTTCATGGTGCCCGCTGGAGTGCGGATCGACACTGCGGACGGC
ACGGCGTGCCTCCCCGACGAGGTGCATATCCAGATGATCGGACGAAGACCGCTATACAGCGCACGGATGCACCCGGTCGATGTCAAGACGCCTGTGAGAC
TCGAACCAGGAGACACGCATGAAGTCTTGCTGAGGCCGGATCGAAACGCGCCGTTCCTGTGGGTGACACGGGCAGAGTCGTGCGTGACTACCTTTGTCAA
AGGGAGAGTCGGAAGGAAGACGTACCTGCGTGTCACGAACATCGGAGATGCAGCGATAACCCTCGACGCGCATGAAACGCTTGGGTGGTAGACGCCGTCT
GACGGCCAGCCTCGGAACCGTGGATTCGTCCGACTGGGCTCCACCCGGTACCAGCAGTGGCAGAATCTGGCGTACGGCGCGACGCACGACGCGGAGGAGA
ACTGGATCCCAGCCGAGCTGGACGGACCGATGACGGATCGCTCCTCATACCCGACGCCTAAAGCCTTCTTGCGCCCGGAGCCGAGACAACTCGGGACGCG
ACGCGCCGTGACCCCAGTGTTGGCGGCTGTCGTGGAAGCGCCGAAGGCAAGGGGGGTAGACTTGCCACCCGACGACCACAAACCGGATACGAACGAGGAG
GCGGTGGAAAGCGAACCCGATATGCCTCCGACTGTGGCTGGAAGCACTGCGATGGAAGAATCGCCGAAATCGGAACTCGCCGAGCCAAAACTCGACGGAC
CAAACCCCGCCGAGCCGAATTTCGACGAGGCGAAACCTGATGAGCAGGAGGAAGACGATGCTGTCCTCATCCACGAGGGGTCCGACCTCTTCGCCGAGGA
TCTCGAGTCCGAGATGGCAGTGGTGTCACACCTCTCGCTGACCGCCGAGGTGAAAATCGAAGACTTAAAGGTTGGCATGCCGACTGGACTCCCGCCCGAG
GAAGCCGCAATACAAGAAACGCGGCTACGCCAAATCGTCTGGAAGCGACGAAAGTGGTTGATCGACAAGGGCAACGCCTTGTCGCCAGCCGCCCTGGGTG
TTGTCTGCGACATCGACGTGGGCGACGCAAAACCCGTCGTGCAACGCGTCCGGAAAATCCCGCCGCAGTTCCGAGAGAAGGTCGCACACTTGATCAAGGG
GCTGCTGAGCGCGACGATGATCCAGAAATCGAAGTCGCCGTGGGCGTCGCCCATTGTCGTGATCATAAAGAAGAACGGCGTCGATATCCGGCTTTGCATT
GACTACATGCTCATCAACGGGCTGACACAGTTGATGGTTTACCCCATGCCGCTCGTCAACGACTTGCTCGAAGACTTGGACAAGTATCTGTGGTACTGCT
CTATCGACATGGCGAGCGGCTTCTGGGTCGTCCCCATGACAAACCGGGCCCGGCTCATCTCAGCCTTCATCACGCCGATGGGACTGTACGAATGGTGCGT
ATGCCGTTCGGCCTGTGCAACGCGCCGCAGATTTACCAACGCTTGATCTGACAACGCGCTCTACGGGTTCATGAAGCTGTCCCCGGATGGCAGCACTCGG
GACGTCTTTGAAGACGGCGAACCGGTGAAGCCAGGTATTCACTCCGTTCTGGGACGGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACGAACCGCGCAGACGGTGGCCGAGGCGTACGAGGAGGCGGTGTTCAGGCGCTTCGGCGCGAGCG
AGGCTATCCGCCACGACCGCGAGCCGGGTTTCATGTCCGACTTCTTCAAGGCGTTCAGCAAACTCATGGGTCAGAGACAGCGAGCGACGCTCGCTTATCG
TCCCCAAGCCAACGGTGCTGCAGAACGGATGGTGCAGACGGTTACAAGAGCGATCAAGATGTACATCGCGGACGTCGACCAACGCGACTGGGACGAATAC
GCCGAGCGTCTTACCTTCGCGCTAAATACGTCGCACGACCGGACGAGGAACGAAACCCCGTTTTTCTTAGTGCGCGGCTGGGATCCTCGGTCGAGGCTGG
AAGCGACGCCGGCCGTCGGGAACACGTCTACCCGGGACTCCGAGGCGAGGCGGTGGAAACTCCGCATCCAGCGACACTACAAGGTGGCAAGGGCACAAGC
GTTGGAGTTAGTCCGGGAGGCCGTCGAAGAGAGAGCGCGTCGACAAGCTGAAAACTCGACGGGCTCGCAAGTTTGGCTGTACCTGGATCGGGTGAAGCCG
GGGTATGCGCGCAAACTCATGCACA