Description :
From Genome Similarity Track
Location :
Scaffold_188:18386- 20021
Sequence
1635 bases(100 bases per row)
CATGGTGCAGTTCCGCAGCACGCGCGGCGGCGTCCGCGGCCTGTCGTTCGAGGAGACGGTGCTCACGGGGCTTGGCGCGGACCGCGGGCTCATGGTCCCC
GAGGACGGCCAGTTCCCGAAGCTGCCGCCCAACGCTCTGCAGACCTGGGCCAAGCTGTCGTACCAGGAGCTGGCGGTCGAGGTCATGGGGCTCTTCATCG
ACGAGCGCGAGATCTCCAAGGCCGAGCTGCGCGCGCTCGTGGACAAGAGCTACAACGAGCAGACGTTCCGCCACGCCGAGACGGCTCCCGTCGTGCAGCT
CACGCCGCAGCTGCTCGTGCTCGAGCTGTTCCACGGCCCGACGTTCGCGTTCAAGGACATTGCGCTGCAGTTCCTGGGGAACCTGTTCGAGTTCTTCCTG
CACCGCAAGAACGCCGCCAAGTCGCCTGCTGAGCCGGCCCACAAGATCACGGTGGTTGGCGCCACGTCCGGCGATACGGGTTCCTCGGCTATCTACGGTC
TGCGCGGCAAGGAGAACGTCGACGTGTACATTCTGTTCCCGCAGGGTCGCGTGAGCGCCATCCAGCAGCGGCAGATGACCACCGTGCTGGACGCCAACAT
CCACAACGTGGCCGTCAAGGGCACGTTCGACGACTGCCAGGCCATCGTCAAGGATCTGTTCGCGGACGCGCAGTTCAAGGCGCAGCACAACCTTGGTGCT
GTCAACTCGATCAACTTTGCGCGTATCCTGGCGCAGATCGTCTACTACGTGTACGCCTACTTCCGCGCCAAGGAGGCCGGCGTCGAGGACGTGTCGTTCT
CGGTTCCCACTGGCAACTTCGGCGACATCCTCGCGGGCTTCTACGCCAAGAAGCTCGGTGTCCCGCTCGGCAAGCTGGTGGTCGCCACCAACGAGAACGA
CATCCTGCACCGGTTCTTCTCCACGGGCAAGTACCACCGCCACGCGATCGAGCACACGTCGTCGCCCTCGATGGACATTTGCGTCTCGAGCAACTTCGAG
CGGTACCTGTTCGCACTGAGCGGCGAGGACCACGAGGCGCTCCGCGGCTGGATGCTCGACTTTGAGAAGACGGGACAGCTGACGATCGAGGGCGAGCTGC
TCGCCAAGGCTCAGGCCGACATGGCGTCCTTCTCGGTGCGCCAGCCCGAGGTCGACCGCACGATCGCCGAGTACAAGAAGGTGCACAACTACCTGTTCGA
CCCACACAGCGCGATTGGTGCCGCCGCCGCTGCGCGGTATGGTGAGAAGCACCTCTCTGGCAACCCGAAGGACGCTGTTGTGGTGGTTGGCACGGCTCAC
TACGGCAAGTTCCTGCCTGTGGTGTCCAAGGCACTGGGCGTGTCGGAGCAGGACGTGGAGCAGCACCCGAAGCTCAAGGCGCTCGAGACGCTGCCGACCC
GTCTGGCTGTTGCCGACAACTCGAAGAGCGTTGTCGCCGCGCTCATCAGTGGCAAGGCCGTGAAGAAGACGACTACCAAGACGGTCAAGGTTGGCGGCTC
GCCTTCCAAGAAGCCTGCCGCGACTTGCCCGATCCCGTTCCACGGCTCGGGCATGTTCGTGACGGCCTCGCTCGTGGTCGCCGGTGCCGCGGCCGTCGTG
TTCTTCGTGCTGAAGCGCCAGAACCACCACTAGAG