Description :
From Genome Similarity Track
Location :
Scaffold_4:1838572- 1839927
Transcript NameFunction/comments
Phyin_T30-4PITG_03453Phosphatidyl inositol kinase (PIK-G1)
Phyin_T30-4PITG_03454Putative uncharacterized protein

Sequence
1355 bases(100 bases per row)
CTTCCTGGGCATCGACGCTGATTATATTTTATTGCGTCTGCGCTCTCGCTTCAAGCTGACACTATCCAAGCAAGAGACTGTGGCGCACGTGCTGTCGCTC
ATCCGCAAGAGCAACAACAACTACAGCACGCGTCAGTATGACAATTTCCAGCGTATGACGAATGGTATTCTTTCATAAGGTGACTGGGTTCTCAGAGTCA
AGTCGCAAGCGAATAAAAGATCGAAAGCCTTTCGGACAACGAATGTCCTTAGAACTATAAGGTGCGTGCTTTTCAAGCACGTAGCGTTTTGGTAGGTAAG
TGTATAGGTTGCAGTTGTACCTTGTCGGGTGGTAACGATCCAGGAATGAACGCTTCCGGAGAAATATCATTTGGCCGACGACAGTCTGGTGCTTCGTCAG
CATCATATCTAAAGTTAAGCGGCAAAGTAGCTTCCCAATCCGTCACGTTTCCGCAGCATGCATCTCCGCGTGAATCCAGTGTGCAGTACAGAGAAAGCCA
CAATGACGACGGCACAGGCTAGAGCAACCTTGGTGCCTGAGGAGGCGTCGGAGATGTTGGTGAGCGATTCGCCAGAGTCTTCTGCAACGAGCAGGTTGAA
ATACACGGCGGCAACGAGCGAGACGAGCGCGATAAGACCCCAGATAACTCCCCAGCATCGACTTGAAGTGTGCGTCATCTTGGCAAAGACCGAGGCGTCG
CTCTCGTTTACGCGACGGGAAATGAGGTCGTCCCAGATGTCGTAAACCGAGAAGAGGCAGCTCATGACACCGAGGAAGAGCGTCACGTATTGGAGAGCGT
CGAAAGTCGTCCAAATGTTCAGTGCTAGCAGACCCGCAAGCAGCAAGATGAAGCAGAAGTTCAGGATGCGGAGGTAGCCGTTGTGTGCGTAGAAGATGAA
GATCAGGAGGAAGAAGATGAGGACACCTGCTGCCACTTCAGAAGCCGTTTTGTCGGCGCTTGCGATCGTCAATGCCATGCCCCACACGGCCGATCCCAGG
TAACCCTGCAGTCATGAACACAATCGTGTCAACATCATATTTATACTGTGCCACGCAGGGTTGGCAACGTACTGCAGGGAGGATAACCCACTGGAGTCCA
CCGATCGTCTTGGTCACACCACCTTCGTCAGGATGCACCTCCATTCCTTTAACCTACATTACAAGCAGCAACGACATTAGCTACAGCATCGCGCTTGTAG
TACTTATAGGACGCTGCATACGCTGCCACAGGTGAGCCACGCAGCTGTCGCGTGCCCCAATTCGTGTAGGAACACCGTTCTGCGTCATCCCCGGTGTCAT
GCAAGGCCCATGTCATGTTAGTGCAGTGTCCGCCGCAGTTTACGGCAGCAATACG