Description :
From Genome Similarity Track
Location :
Scaffold_285:18385- 19825
Transcript NameFunction/comments
Phypl_g6451hypothetical protein

Sequence
1440 bases(100 bases per row)
attaaccctttcgcgatGAAAGGGCGCATTTTTCGCCCTTTAAGGCATTTCGCAAAACAAGGTAGAAACACCTCCGCTAAAAAGGTGACATATGCGCCCT
TTAAGACTTACAGCTATTGCCAGTTATCGGGTTTTGATACTGAGAGTAACTACCATTCATGATGTAGTCGGCTAAAGGGGTAGTAGGATTTTTTAAGGAT
CGATCGGTTATTTTTCTCCCAGATCCAAGTCCACTGAAAATATGATGCCTCGTCGCCAACATCACCTGATTTGTTGGCTATAAAATGTGAATTTTACCAT
CCTGATTTTATCTTCCCACGACATAAAACACAGATCTCATATCTCAGTTTTATCATGCGGATTCCTCCCAGCCATCCACGGCCCATACAAAACGTAGTAC
ATATGCATCACTGGTGGGTGCATCCAGCATACTGATTCCAAGATGCATGCAATTCTGTATTTATCATGCGCACTAGCTTCCACGACTGAGAAAACAAGCA
CCTCGTGCAGATTGCACTACAATTCGAGAGGGAGGGAATACGCATTACATGGGACTATGTGGAGCAACGCATGTCGAAGGCGAAGTGCCctgcgcgccag
ctccagctacGCTTGATCAGCCTCAAACGAACTTACGGTAAACCTATCCGGAATTTCCCGCCATGCTTCATTGGAAATGCCAATGCGAACGTCGGCTCTA
GCTGGCCAATCCCTCCACCAGCGAGACTGCCACCAACACTCGCACCGCCAGTGAGATCGCAGGCCCCACCGCCTCGTCGACGGGAGCCAGAGCTGACAGT
GAGACCGATgtctgcgccaccagcaagACACGTCACCGCAACACCATCGAGATCCAGTGCCAAGATGACAGTGACACCAAGGCCCTCGGCATTACGACGA
CAGATACAAGAGGTGCCAGTGCGAATGATATCTACTCAAGCCGAAGGCTGCAAGACAGCCCTGCCGAAGGTAGCTCCGCCCTCCGGATCCACGCTTACTT
CGCCACCGAGACACGTTCAACTGTCCTGCCCAACCTcggcacgagctgcaagatCAGGGCTTCCTAAGAGAGCGCAGTCGCAGGCCACGGCGCCACATCA
ACGGACGCCAGAGCTGTCCGTACCGCCAACGACTCCCTCGTCTCCGCAGGCGTCATCTCCAGTGAGGGCAGCTTCTGAAACTCCGTTGCTAACACTACCT
GAAGTGGCACAAGCGATAGTAGCCATATTTGGTGACGTGAGTGCAGACGATGTGAGACAACAGGCTGGATGAATGCTGGAGAAGTGCTTCCTTCCGGTGT
CGTCGATCCAGTTAATGCGATGGGCCCTTTCACTACTCAGGACCTATTCCTTGACATTGGCGCGGGTATAGGCAATATCAGAGCATGCGTCGGCATTTAG
GTGCGGGCGGGGTTGTGTGCGCTCGGAGACGCACGAATTG