Description :
From Genome Similarity Track
Location :
scaffold_74:18383- 24458
Transcript NameFunction/comments
g2817.t1hypothetical protein

Sequence
6075 bases(100 bases per row)
GAAGTGACCTGAAGCGACACCAATCACATCCAGGATCGTTGATGCTCATGGCGTCTGTCCTGCTGGTATTTGTGCTGCTGCTGCCAAGTACTGGGGCCTT
CCGCGTGGTCAACTCGCCGACCAACCCTGTGGTAGGGACGCACGCGGTGTTCGAACCGTATGAGACGGGCTCTGTGGGCTACTACGGGGATCTTGCCAAC
CCGTCGGCCGAGCGGCTGAACGAAGGCTCGCCGTACTCCCCTGACACGCCGCGGATCTTCTTCAGCACTCCATTACTACGTGCGTCTGGAGCTTGATGAT
GATAAATTTGAGCTGATAATCAGTGGACTGAGAGTCGTTCTCCGCAGAGTCGTGTCCAGGGATGGTGGGGCCAGGACGCAACGGCGAGTACTACTGCTTC
AGCCGCGAGTACGGCCACTGCGACCGACGTAGTGGTCTCTGTGTGTGCAACCAAGGCTACACTGGTTTGGACTGCACAGCATGCCAGCCGGGCTTTTTCA
AACAAGGGGGCTTGTGCTTCGCCAAGAGTTGAGTATCCATCCATGTCTGTTGGGTATCGTTTTGCTTTTATCTAACCAGCTACATTTGCCTTACAGAAAG
CTGTCCAAACGATTGTTCGCGTGGTGGCCAGTGTGACTACGCGACGGGTATTTGTATGTGCGAACCCACACGGCGTGGAACAGACTGCTCTCAAAGATTT
TGTGCCTTCGACGAGAAATGTGTGAGCTGTACGAGCACTTCCTGTCTGAAATGTGTCGAGCGATTCTACGTAGACCCATCTACTCAGACTTGTGGTACGT
TTTTGGCGCTGATTTTGTGGTCATGCGCTCTGAAACCTTTGACTGACTGGTGTTACGTAGTGTCGTGCGCGCGCTTCGATCCGCGGTGCCTCAGCTGCAA
CTCCATCGGCTGCCTTGGGTGTGCAGATTTACAGCTCAACTCAGTGCGTCGTAGTGGAGCGCGACGAATTGATCCACCACTGCCGGACGACGAACGCTTG
CGTGAGTTCTCGCAGACTTTCGTTTACGGCAGCCAAGACCCGCGGGTTTTCGATGAAGCCGAGTCGTTCACGCTAACCCCATCCTCTTCCTCGTCGTCAC
CTATGAACGAGAGCAGTGTTGCCTGCATCCAAGGCGGAAATGCGGACGCTGGATGGACGTGCGCGTCTCGTCCTGAATCACATCGTGTTTGTGGGCATCG
CGGTGTTTTGTCTTTTGCGTCGCCACTGTACGCAATCGCTGAGAGTGCAGGGGAAATTACTGTGACGGTACAGCGATCCGGAGGTGGACTTGGAAGTGCT
GCGTTGCTGTACGATTTGGAGCACGTTACCACTACATCAGGAGATGTTTCTCCTACGGTGTTTTACACCAGTTCACAACGGCTGGAGTTCGGTCCTGGAG
TTGTGTCGTTGTCCTTCAAGTTGCAGATCCACGATAATTTCGTCTTGAAAGATGACAAGACTTTCAGGCTTCGTCTTCGCGAACCATTTCCTCCGACAGA
CCTACTTGACGTAGCACCTGCAACGTTGGGGAATCAGTGGCGCACACTCGTCGCCATTTTGGACGATGATGCTTCTCGGCCGGTTCCCGGTCTTACGCAT
GTAGTTAATCCGGAGTCTACGCTCATGCTAGGTGGCGCCGCTGGAGACACGATGACTTTCCAGATCCAGAGTGTCTTGGGGAGTGGAGTTCCGGGCGCCG
ATCCTGCCAATCAAGCGGCCCTCCTTTTGACCTCCTACATCGAAGAATATGATACCAGTACTGGGGCTGCTGTATTCCGGAAACTTTTGCTTGGAACTGC
CGCGCCTAGTGGGGGAGTGGATGCATCGCTGCATACGTGCACTTGGTCACGTGAACGTGCTGGCAATTACAGTGTCGCAGTTCAATTGTTGTACCCTGGT
GGGTTGCGCGGAGAGTACTTTGGAGATGCTTGGCTAGGAGAAGCGTTTGACTCGACATCAACTGGCAGCACTGCAGTTGCGCCCATTGTGTCGCGGATTG
ATCGCCAAGTCAATTTCACGTGGAATACAGGTCCTGCGTTCCCTGGAGCTCAGAGTCACTTCTCGATTCGGTGGAGCGGTTGGCTTAAGCCTCGAACCAC
AGGCACAACTATGCTCGGAGTGTCGGTAGTTGGCCATGCACGCTTATGGATCGACGATGTGCTAGTCATTGATCGTTGGGGTGCCGGAGGTGAAACAAGT
GACGGTTTCCCTGCAATCAGAGCGGTGGCGGGAGTGACTTTGGATGTTTCGAAATTGTATTCTTTGGTTCTCGAGTATCGAGCACCACGGCAGGGAGACA
TTTACGTCCGGTTGTTATGGGGAAGTGTTGGAAGCGCGAAGATGGATGTTATCCCTGACCAGCAGCTCTTTTCAGGGAGTCACATTCAGAATTCTCCATT
TACAAACGTGATTGTGGCACCATCGTTGACGGCGAGTTCAGCATTATTAACCTCCACTCTCCTAAATGATAAATCGTTCGTATCCTCCGCGCTACGGGTG
GTTGCTGGTGAAACACTTTCTTTCAGTGTCTTGCCGCGTGACGTTTACGGTAATCGACGACGGTCACGAGATCAATACACTCGCCGCGACGACATTGCTG
TAAGACTTACTTTGGGGACAGATCGGAGTCTTGGAGGACAAAGTACAAAAACGGAGGACGCATTGGTATCTTGGAATGGAGAATTAGACGTATTTCGCGT
ACTGGCAAGGCCGCAGCGAAGTGGTGACTATTCTATGAGCGTAAACGTCAATAACGTTGCATCGGGGGCAGGTCCCTTCGCTGTAGTAGTCGTGCCAGCC
AAGCTTAATGCAGCAAAGTGCGTGCTTTCTGGGTCCGGTCTACTACCTGGTCGCGTTGCTGGGCAGCCTGTTACTGTGGCGCTTGAAACTCGCGATTTGT
ACGGAAATCGTATCTACACTGGAGGGCTGACCGATCTGAAGCTTCAGGCTTCTCTCTCATCCAGCGTTGTTCCAATCGTAGCAGTGGGCTCAATTGTCGA
CAACGCCGATGGAATGTACCAGTTCACGTACACGCCTCGAGTGGTTGGGAGCTACAGTGTCGCTGTCACGTCGAAAGGAGCTCACTTGCACAATAGTCCG
TACGTGGTTACTGTCGTACCCAGTACTCCGGTAGGTCCGACAAGTGTCGCCCAAGGTCCAGGTATATCTTCTGCGAAAACCAATGTCCAAACAACTTTCG
AAGTGACAGCTCGGGATTCCTCTGGTAACGACGTGGCCACTGGCGGAGTTGCATCAGCTCTTACTGTAATACTCAAACACCCTGAGAAGGGCAACGTGAA
TGGGAATTCTTGCACCGACTTGTTGAATGGGCAGTACACGTGCACTTACACAGCACGATACGTTGGCCCCACACTTCTACACGTGACGTTATCCCAGCAA
GAGATAATTGGAAGCCCGTTCTTAGTGGAAGTCACGGCCGGACCAGCTCTTGGATCTCGATGTGTGGCGGCAGGTGGTGCGCTGGTTTCAGCGGTGGCTG
GACAGAGAACAAGTTTCACTGTGAGCATTTACGATGCCTTCGGAAACGCGAAAACTAACGCTGGTAGTGAAAGTGTCAGCGCCACATTTACCGGTCCAGG
GGCAGCTACAACCGCAGTGAATGCCGCAGTAGCAGTGACATATAATGGTCGTGGGGTTTTCCTTGTAGCGTACACGCTAAGCTTGAAAGGAAGCTACAAG
ATCAGTGTGACTGTGGATAATGTGGCAGTTGATTCGAGTCCATTTACTATGTACGTGTATCCAGCATTGGCATCCCCGACAACGTCGTCATTGGATTTGG
TCACCCCAGCAATGCCAAGAACTCAAGTTGACCCACCAGTGGTATTTACGGCAGGTGCACTCATTGTGGCAAGGCTCACCGCTCGAGACAGCTTCGGAAA
TGTGCTCGAGACTGGGGGCAATCTGTTCCGCCTTGACGACGCTGTGCGTGCATTTCTCGAAGTACCAATTGCCGACGGGAGTGATGGGACCTATTTGGTC
ACATTACGACCAAAACTCAGTGTACGCTTCCCATTTACACCACAGCTGATGATGCCTGGAGGTTTAAATGGCTCTTACTACTCTACAAGTGCAGTTCCAG
TAGGGATCGCCACTGCTGAAGCATCTTCAGATCACTCGTTGCTGGTGTTAAAGCGGCGTGACGCAACTATTAATTTCGATTTCGGAGAGCGACCACCATC
GCACATGTATTCCGCTGAAACGTTTAGTGTGCGCTGGGATGGATTCTTACTGCCTCGTTTCAGTGAAATCTACAATTTTGAAGTCAATGTCTTGGGCTTT
GCCAGTCTGCGGATCGGCAGTGATTCAGTTGCAGTCCACGAAGGTGAAACGAGTTCTTTTATGGTGGTTCCTCTCACAGCGCAAACGTTTGTGGATCTGG
AACTCAACTTCTCCAAGTCCCGGGAGATACCCAGCGCCACTGTAACTCTTACGTGGAGTAGCCCCTCACAAACTCGTGAAATAGTTCCATCATCTCAGCT
CTTTACGTCTTGGAAAATTGTAAACAACGTCCCGTCACTCGACATCAAGCCTGCCACTGCAGACCCCACGATGTTCACTCCAGAGTTTGGTAGCTCTCTA
GCACCCGGATCGACGGCCGTACGTGCTGTGGTTGACAAGTCTCTAATCTTCTCCGTGGTGGCACGTGATAGCTTCAGCAACAAGCTTGGCGGCGAAGATT
TGTGCTCCTTATACGTACTGCTTCCCCAGGCTCCAAGTGGGAGCGCCCAGCCCGGCGTAACCATCACTGACATGCTTGACGGCTCGTACAAGGTCAACCT
GGTTCCGCATCTCACTGGTGTTTTCTCGTTATATATCGCTGCGCTTCCCGATGTGATGAAGGCTGGTGCTCCGCCTGGAGGTGACGCATTGGTGGCTTTC
TTAGCCCAGTATAACATCAAGGGCAGTCCATTCAAACTCCAAGTCGACCCTGGACTGCCAAGCGCAGTAACTTCTACACTGGTAGGGGGCGGCTTCGTGT
CCACAACAGCAGGAGTTTTCACTTCCTTCGTGCTGGAACTTCGTGATGGCAGTACTAACCGCCTCACAGCTTCTATGGTGACGGCGTATATCGCACAAGG
ACAAGTCCACGTCAAACTCAGGAGCATCAGTGCAGGTACCGAGGTGACAGCGAAGGTGTTTCAACTCGGTGGAGGGGATCTGAACTCTTTGTCGGCTCAA
GATGTACGCGTTGAGTATACAGTTACTCTTGCCGGTCTGCATGCCGTGCTGCTGAGTGTGGATGGAGGCAACTCGTTCGGTCAGAAGACAACAACGCTGC
GAATTTATCCCAACGTGGCCACAGCAGTGACGTCCTTCGTCTCACCTGACGGTGCAGGAGTGGCCCCGACCGGTGCTGGTTTAGGGCCACAGATCGTCAC
CACACAAATCTACACGTACCACGTCACTGTTCGGGATGCATTTGGCAATATTCGTGACAGCGGCGGTGACCTCCTTGTTGCCCGTATTCACGGCCCTGAC
AGTTCAGGAGGTAAAGTGACCGATCTAGGTAATGGCGACTACGTCGTGCTTTACCGCGTTATGCTTCCTGGCACATACGAGATCGAGACGCGAGTTGCCG
AGCCACAGCACGGGCTGGTAGGATACTACTACGTTGATACGGAATCTCTCCAGCGAAACGCAGGAAGTGCCGTGCGTACGGTGGACGACGTCATCGACTT
CGACTGGAGCAAGAATGTCACCATGCAAGGGTACCCGCGTGTTGTTTGGCGAGGTTTCCTCCGCCCACTTTTTGGGGAAGAGTACACACTGTGGGTGAAT
GTCCAAAGCGACGTTGGGAATGCCGCTGGTGTCTACATCGACGGGCAGACCGTAATTGATGGCCTGAACACTGCTGCAACTTCCGGACGCGTGGTGCTTT
ACGGTGGTCGACTTCACGCCATTGTTGTTGAATACCGAAGCGCCTCATTGCAACCGTATTCTGGATACCTGTCCTTGTTCTGGAAAAGCGCTCGACAAGC
CTCCCAGCTCATTCCAACACAGTTTCTCATAGCTGAGGCCTCCGAAATTCTTCCTCGAACCCAGCTCATAGCAGT