Description :
From Genome Similarity Track
Location :
Scaffold_172:18382- 19579
Transcript NameFunction/comments
Physo_144195hypothetical protein

Sequence
1197 bases(100 bases per row)
TTTGGTGAGAAGATCCTCATTTATGCACCGGTACATTTCTCATGGTATGGAGATCACCAAGACTTACAGCTTCATCAAGGCTAGCTCTCACAAGGCATTT
GCACCATTCATGGAAGCCGTATCGAGCGCGCGACGAGAGGGTGATGAAAATGTTAAATCCATCTGTAAGATCATTATTGAGAAGGTATCTGACACTGATA
TGGATGATTTAGTCCAAGAGTTGAAAAAAAATCATTACGAACCCTAAATCATTTGATGCGCTCATTATCGATAGGTTCATGAATGAATCGACAACCAATC
CTAAGATTCATTTGGTTCTAGACTTGTTGACTAAGCTGAAAACGCTTAGTGAGGGTAGCAATAATAAGGCTATGATTGCTGAGATGATGAAACTGGTTGG
TAATAGTGCGTTTGGTCGATCTGGCATGGACATGAGCAAGCACAAGGAGGTCAGGTATGAGTCGGACGATAAGGCAATCAAGGCCAAGATTGAGCACTTC
ACCTTCCACGGAATGGAAGAGCTGAATTATTCATGTGAATTCACTATGAAGAAGCGAAAGCTCAACAATAAGAACCCAATTCATCTATCGATTGCAATCT
ATCAGCTCGCTAAGCTCCGTATGTTGCAATTCTACTATGATTGCATTGACTTCTACTTCGACCGTTCGGAATTCCAGTACCAAGAAATGGACACAGACTC
GGCTTATATTGCGTCCAGCTGTGAGAAGCCATTCGTTGAGTGTATCAAGCCCGAGCTTCGTGAGCATTTTCAGCAGCATAAGTACGAGTGGTTCCCACGT
GATTATAGCGAAGAGATGGCTCAGTTTGATCGCCGAACGCCAGGTTTGTTCAAGGATGAGTGGTCTGGTGATGCTATGGTATCATTGTCCTCTAAGAACT
ACATTCGCTACCTACCAGACGAATCTTACAAGGTCAAGGTTTCAGCGAAGGGATTCCAGCAGAGTGGTGGCCGCAATGGCGACGTCCTCAACCCAGATGG
CTTTGAATCGGTTGTTCGCGATCGCATCACGCTACAGGGCACCAACAAGGGGTTTAGACTCAGTAAGGAGAGTAAGTCAATCATTACGTACACCCAGACT
AAAACAGCTCTAAACTACTATTATGACAAGCGTCGTGTACTTGCGGATGGTATCACCACCGAACCGCTCGACATATAAGCAAGTACCTGGCAGGGGA