Description :
From Genome Similarity Track
Location :
Scaffold_77:18380- 19736
Sequence
1356 bases(100 bases per row)
AACTAGCCTTTTACCATTAATGTATGGGTTGATGACCAAGTGGGACAAGAAGCGATTCTAGGGAATATATTTTATGGTACCGGCCGGGATACGCCTTGAC
CTGGCGGACGGAACAGTTTCTTTGCCGGACGAAGTCAGAATTCAACTGGAAGGTAGGAGACCACCGTATGGGAAGAAGATACAACGAATTGACGCGAACA
AGAAGTACTTGGCGATCCTGGTAGGTAACTCCGTAGAAGTCAACGTTGGCCCAGGCCACTGCAGTCAAAATTGTGGTTAACACGCCACTCACACTGAGCA
CTTACGGCTACGACTGGACCTGGAAGGTTGACTTACCTTCGCTTGTCCAATCTGACTGAATCAAGAGGTGATCATTCAACAAGGGACACCATTCGGGCAA
TGAATGCCGGCGGATATGATAACACGATCACACGGGTATGTGTCAGGAGGGTCACAGAGATATCAGGAGTGGCAGACACTTGTGTTTGAAGCAACCACGG
AAGAAGAAGAATTTCCTGAGGTAGATGGGCCTCTGGTTGATCACCCGTAATATTCGATGCCAACGCGCATTCTAAAACGACCGCCGAAGGATATAGCGGG
GACGAACGTGGAAGAATAGGAAGCAAAGTTGAAAGGTGATATGCTGATGTGTGATCACGTGGACAAACAAGATAACCTTGAAGTACCACAATCAAGACAG
TTGCCAGTGGTTATTAACGCGATCATCACTCCTGGTAGGACTAGGGACGGGGATGACGGTGATGTGGTTTGGATCCGGTGTCCGATCATCTGGGGCAAAA
TAGTGATCCAAGAGAGGAATATCGATGCGATTGCCAGTGATAGTCGACATGAACACCCCCATTGACGTGATTAAAGACATCAATATTGTGCGGTAACAGT
CAGAAATACAGCCGAACGATTGTAAGGGAGAACTCGCTCCTGAACCGATCAATGAGTTGGTACCTGATCGTGTGCAAGACCGGTCCACCAATCACCCAGA
CGTAATCACTGGTACGGAGTTTGAGGCACATTGACCGTCCGACCGTCAGGCGAACCAAGAAACACCAATTACAAGCTAAGGAGCACACGATTGCTCGTCA
TACTATTACGAAAGTGGGGTGATTTTGCGGGGGATGTAGACCAACACATGGCAATCTTACCAAAAGTAGACGTGATGCTGAGAGAGGTGAAAATTGGCTA
TATACAGGTGGGCGATGCAGGAGTCTTATTGACCAAGGAGCAAGAGGAATTACTTCAGCTGATCTGGAAGAAACGACACCTTCTGATGGGTAAAGGAAAC
GCCCCCTGCCTGCTGTGCGAGGTGTAATCTGTAATGTAGATGTCGGAGAAGCAGCC