Description :
From Genome Similarity Track
Location :
Scaffold_2094:1838- 3264
Sequence
1426 bases(100 bases per row)
CTACCTATAAATATACTCAGTTTACAATCTACCTTATTTAGGTCACTTCGCTCTCTTTAATTAAAGAGGGGACCTGTGAACTGCCGTTCACTGAGAGTTT
GTATACTCTCGGAAGATAACTTCCTCTAGCGCAAGGTGCTGTGTGACCCCGTCACACTTGGTAGCACTTGTAGTCAATCCACGCCATCGCGGGTAGACTA
CCTGAACCTCCGAAGTTCGTTGCCATGGATAGGAACGACTTCTCCCATATGAGCGACTCTCAGTTCGAGTCGGTTCGGAAGATGGCAGGCATCTTCGGGA
TGGAGGCCCTGCAGAGCCTGGTGGTATCAACACCGGCTGAGCAGCTCGAGCGCGTCAATGCATTCGACGCGTACGAGCAGGTCCTCATCGCGCATGTGCG
GGAGAACCTGCAGGCTCCGGCGGCGGAAGCAAACCCGCCTCACCCGAAGCCAATACGGCTGAAGGTAAAGCCGTATGAAGGGAAGGAAGGCGAGAACCTT
CACTTCTGGGTCCGAGAAGTAGAGCTCGCGATGGACGCGGCTCTGATCTCGACCGAGCAACTGCGTGTTGCTTTTGCACTCTCCAACCTTAGCGGTCGTG
CTAAGAGTTGAGTGTACACTCGGGAAGCGACATCCCCTGGATGTTTCACATCCTGGGCTCAGCTGTGCGAACAGCTCCGAGCCGCGTTCCTCCCGGCGAA
CTACGAGTACCGCCAGCGTTCGCGCTTCCTCGCGTGTAAACAAGGAAGACGCGAACTGCACGAGTATGTGCAAGAGATACGGGAGCTCACGGCGTCCCTA
GTGGGAAACCCACTCAATGAACACATCAAGATGACTGTGTTCATGGACGGCCTTCGAGTGGGCCCCGCACGCACTCAGCTGTTCCGGGTGCAGGCAAGCA
CCCTTGAAGAGGCGATTCAAGTGGCTCTTCAAGAAGAATACAGCCATCGCCAGGCGCGTACGCCGGCCTCAGCGTGGCCTGGGAGTTCCTTGTCGGCTCC
CGGTCGAACAAGCCCCAACGGACCAGTTCCCATGGAACTCGGGTCCGCCGAACAGCGTGACATCCGCTGCTTCGGCTGTGGGAAGATGGGCCACTTCAAG
CGCGACTGTCCCGCGGAAAGACTCCGCAGACGGTCCTTCCCCAAGCCCGTCCTCAAGGGTCGCTGGCAGAAGCCAGGATCCCGGGGACAGGGGAACGCAG
GGAACCAGTAGGGGCGGGGCGCCCTACTGGGGAAGAACTAAGTCTTCGTGATGGGTGCGCGGGTGGCGCGTACCACGGGGACTTAGCCCCTGAGAGTCTT
CGCACTCTCGAATCGGCGAAGAGCAGCGGCGGGTTGCTCGTAGTACACGGATGTGTACGGGGGTACGATCACCCCTTTAGAATCTTGAATGACTCTGGGG
CGTCGAAGAATTTCGCCCGCCGCCGG