Description :
From Genome Similarity Track
Location :
Scaffold_838:1838- 3165
Transcript NameFunction/comments
Physo_145271hypothetical protein

Sequence
1327 bases(100 bases per row)
CGAACCCACAGCGATTGTTCACAAGGACACACGCCACCCCAGTTGGAGTGTACATCTCGGTGTACTATCTCCGGCTAGGGTTTGTTCTGGGTGCACCCCA
TTCGGGAGTCTACACCCGGGACGCGCTAAAGCTATACACCGGGGCGGTCAGGCGTTCACCCGCCTCGCCTCACTACGCTCACTCGTTCCAACACTGGAGC
GAGTGTCTGCCGATGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCGTTCTACGTGAATGCCATCAGGCACCCACGCCTCC
CGAGTCTACTCGGGATGGTGGCTCCTTCCTTAAGTGGGGGAGGATCTACGACTGCAACGCAGCAGCCGCAGAATGCCGCTGACACTTGCACAGTGTCAGC
CGCGACTACGCGCAAGAAGAAGAAGAAGCACGCGTCTGTGCAGGGCACAGACGCCGAAAAGAGCAAGAAGAAGAAGAAGAACGGGTCTGTACAGGGTACA
GACACTCGCGAAGACGAACGCAGAGGCCGGGCCTACTGCTAGAAACGAGCTGAACGAGTTCAGCTCGGACGCAATCAACTTCGTGCAGTGCAGACAAGCC
GTCATTCGGTTTGTCCAAGACGCTATCGCAGCTTCTGTCGACCGACAGAAGCTGAACGCAGACAACGTTGGTAGGGGCAACACTAATGAATTCAAGAAGG
GTTCATTGGTTTTGTTAGCAATCAAAACCTGCCTAAACATTCAGTTTCCGACTTCGGGGCGAGCAAGCTCGCTCCGCGCTTCATCGGGCCGTTCACGGTG
TTGGCACGGCATGGCAACGCCTACACGCTAGATATTCCATCTTGCATGCGCCTCCATCCGACCTTTTACGTCGGGCAGCTGAAGCCATACCGGCAGCACG
AGCCACCTAGCTCGGCTGGCCCGAAGGGGAAGCCCCAGCGGGAGCAAACCTCTGCTCCAGCGCGTGAACGCGCTGGGCCAAGCGCGCGACGCGACCTCCC
ACGTCGACAGAGATGTCCGACGCGGTCTGCGAGGCCTGAGCAACTTGAGCTCTCAGGGTCGCCATCTGCTGCTTCAGAGCGGCGAAATCCCGGCTCTGAT
GCTGCTCCACAGCGACCCGCTCCTCGAGCGTCGGGCCAAGGTCAACCCCAGGTTGACCATACCCGGGGCGTGTTCCCACCACCGCCGCCTCCGATCCGCG
ACGCCCGCGGCTCAACACGCTGGATTGTTGAGCGTATTGTGAACCATAGTATCCCGAAAACGAACCGGCAACCGGTTCGTTATCATATTCGTTGGAGAGG
GTTTCCGCCCCACAAAGATACATGGGA