Description :
From Genome Similarity Track
Location :
Scaffold_89:183767- 185161
Transcript NameFunction/comments
g6841.t1XP_009515075.1 hypothetical protein PHYSODRAFT_472847 [Phytophthora sojae

Sequence
1394 bases(100 bases per row)
AGCGGCGGCGGCGCTCCTCGTACTCGGCCTGGATCTCCTCGCTCGTCTTACCCGATGTCTCCGGCACCAACTTCAGCGACAGCACGAAAAAGATGATGAG
CAAGCCGGTGAAGGGCGTGTAGCTCCAGTCGTCAAAGGCATCCGCCAGGTACGGGTAACCCACGCCGACGATGAGGTTGCAGAGCCAGTTGGCACCGATG
CAAATGGACGAAGCGCTGGCACGGATCGAGTCCGGGAAGATGTCAGCCGTCATGACCCACACGAGCGGACCCAAGGTCACACCGAAGACAATCACGTAGA
GCGCCGTGAAGACGATGGAGAGAGCTGAAACGTCCACGAGGAAGGCGACAGTCATACCGATGGACATGACAATCATGCCCGCAATGCCCCATAGGATCAT
GTTGCGGTTGCCGAAGCGCGTGGCCATTACGCCCGTGAAGAAGGCCGGCCAAATGTTGATGAAATCAATGATGAGCGTTCCGATGCGCGAGTCATCGATA
CCAGCGTCCGAGAAGATGTTGCCCGAGTAGTAGAACACAGCGTTAATACCCGAGAGCTGCTGCGTGCAGGACAGCAGAAGGCCGGCAAGGAACTGCGTAC
GGTACTTGGGCGACAGCACGGACTCGGTTGGCACAACGGAGTAGCCCTCTTCGGCCTCGCCGAGCTGCTTTTTAGGCTCAAGCCAGCCCAGCGCCGTTTC
CACGTGTTCTTCACCGTACAGGCGGGTGATGACCTGCCTGGCTTCCTCGCGGCGGTTCTTCATGAGCAGCCACGCGGGACTCTCGACAGACAGCGAAGGC
GATAGCACCATGTAGATGGCGGCCAACACAATGGGGAAACCAGCCAGGTAGCGCCATCCATCACCGCTGTCAGCGAAGAAGAAGCAGATAGCCGGCACCA
GGATGCCGATGGTGGTGGAGATCTGCAGGCCAAGACCCAGGTGACTACGCAGGTGCGGTGGCGACAGCTCGTTGACGTACGCACCGATGGTTCCCGTGGC
AGCACCCGAGGCGATGCCGGAGACTACACGGCCAAAGGCAAATGGCCACACATTGGACACGGATGCCTGGATGACAGCGCCACCGATCATGAAGAAGCAG
TTGAAGAAGAGCAGCTTCTTGCGACCAAGCATGTCGCTAAAGTAGCCGCACAGCAAACTGCCGACCATGGCGCCGAAAATCCATGCGTTCACGGCGAAAG
TCCATTCGAGCTTGGAGTGGCCGCTGAACAGCGTGCAAGTACCGGGAACAACCGGGCGAGCATTGCACTCGTCCGTGTTGTTGTAGTCGGTCAGGTTGAG
CTGCGAGGTGGACCACCCGCTCTGGAATGGCTGCAGCAAGGAGAGAAGGACGCTCGTGTAGAGGATTCGGTTGGGCTTGATCTGGAGCGCGGCG