Description :
From Genome Similarity Track
Location :
Scaffold_62:183710- 185004
Sequence
1294 bases(100 bases per row)
TCTATAGGCACTATAAAAATCATCGCAAGCATGGCGCATATGTAGTCTTCCGGCTGTAGCAGCAGCGTCTCCGGACGCCTAGTCGCCATGTGCCTTTCTC
CAAAGTGTACAGGAAGAAGCACACATCCGCGCCGTGTCCGTAAATCCGGCACACAAAACCCACCATTACGTCACGCAGCGGGGTCGTGACGACCCAAAGA
GCGATGGTTGTCGCGACGCACGCAAGCGTTGACCCTTGCTCACCGAGCATGTAACGGGCCAGATATTTACTCCGTTACTTGCTTACACTATAGTGTTGAT
GAAACTCACAATAGGACGACTAAGTCTTAGGTTTAAGGAAAAATCAACTCTGACTTTATTTTAGGACCGAGGCCACAGACCTGGCCACTCAAATAAACGT
CAAAGTCCAATTGGCTAATGATGTGTCTGGCTCCCCATATATCAGCCAATGGCATGACAGCATTTCAGCACACGCTAGTCGTATGCTGATGCACCTACTT
ATGTAAAGAGATCTACCTACTAATGTAATGGAGGGGTCCAGTTCATTACCCTCTCTTAAAGTTGCACTTACGCAACATAAGCAGCGGGCGAAGAACAAAT
CAATCTACGTGAGGATGGAAAACGGGGACTTGGGTAACGGGCGGAGTGAACCGGGGACGGAGACATCTCCTGCGAAGCGCAGGAGAGACACAACTCAGCT
TGCGGAGAACTTGACAAGCAACACGATGGATCAGCAGCGGACGGGAACACCGACGACGGCGATGTCGTCGATAGCAGGAGCAACAGCAGCGGCACGCGCG
TGATGGACGACCAGCTCCGGACATGGGCTCTCTACGATATATCCGGAGCGCGGGCTCCGGACACACTGGTCACGATGAAAGATCACTTCCGGCGCTCCCG
CGGACTGCGGCAGAAGCCTGTCGAAGGTGTCGCAATATGCGGCGTTGCAGGAGTCGTGGTTCGCTTTCATCCGGCGCTGGAACCAGACGCAAGAAGAAGG
GGAAAGCTTCGTCGGCTGGCTGGTATACCGCGAGGAGATCGTCAAGGAGAACTCGTTCACGGAACATCGTGAGCGCGTCTGCAACAGCGCATGGGAGGAC
ATGCGCCGCATCTGTTTCGCTAAAGGTTGTAGTGCTTGTACCGGGCACGAGTCCGACTGTCGAGGAGTGGAGAAGTCACGTCGCCGAGTATCCGCTCGGT
GAACAAGAATACGGGTGGATCGAGAAGTATCGCCGCCCGTTGGCCGAGAACGTGCGCGCCTCTAGTCTCGCCGGCTCGCGCCGACGCTCTTCAC