Description :
From Genome Similarity Track
Location :
Scaffold_468:18371- 19885
Transcript NameFunction/comments
Phyag_g5963U2 snRNP component IST3
Phyag_g5964conserved hypothetical protein

Sequence
1514 bases(100 bases per row)
agctgcaagaggatagcgactcggaggaggaagacgggGGCAAGGAGAGGAAGCAGAGGGGACTGCCGGGCCACGCCTACGAGGGCAAAGAACTGGCTAC
GGACTTTGACCTGCAGAAGGGTGTGGACGTGTTTGCAGCTCCCGAGGAGACgcacaaggagaagaagaagaggagacgagacgagaagaaggcgaaaaaA
ACAGCgaaaaaaatgaagaagatcgagaagaagcagcagaagattTTTGAGCAAGTgcagaagaggaggcagGAGCAGAGGTTGAAGGAGGAGAGAGAGG
CTGTGCAGAAGGAAGATGATTTTGAGGTGAAGCCGAGTGCAACGGGGTGGCGGGGCAGAATGGAACCTTCGGCCCCACAACCACGGCGTGATGGTGATAG
GAAACAAGCAGATGCGAGAcgagagaagcagcaggataAGAGCTATGGAGGTATGAGCCGCGTCCGCTGACTCTGTGGTCGCTTAATGAACCTACTGCCT
TTGCACAGTTGTGTTTGATGTGCACATATCGATCACGGAATGTTTTGTTGTGTCGCCAACCTACGACGCTCTCACGAAGTGTTGCTATGATTCACATCGA
TTTCCGAAGCAAGGAGCCACATTCCATCTTCGAGAATTGGAGATTCAGGTGCCGCTACAATGGGTTTTCGTCCTGGAGAAGCGTACAACACCCCGAATCG
CAAGGTACTCCGCTACGATTTCTGCAGTTCGGATACTTAAAGGCGAGCCGACTATTGCTATGGGGAGATCACTGTTCTAGACGAGTCGCTTGCGATGACA
CATTGCACTGTTAATGACTCGTTGTACTGATCAGCTTTACTAACATCTACAGTGATTTTATTCATCCTCGTTACGGTTGCGCTCCTAATGCTGTCTGCTC
ACAACCTTCAAAATTGTTGGTCATCTCGTCACTCATCGGCGCTTGGAAGTCATACACCTGCAGCATATTGCGAACCAGCGAGTTCACAGTTGTTTTCATG
TTCATGTCCACCCTGGTAGATAAAATTtcctcatcatcatctcgCATGTCTTCTGGCAGATCGTAATGCCTCTGCCCGCTGCAAACAGCTACCAAAGCTC
TGGTTGGGTCGGGGAAGAACGACACACCATTCGCACAATCCGGAAGTTGGAtgctctcgtccagcagaccACCCGTCAGAGCGTCGTACAGCATCACACG
TCCAGTTCGACTGCCCGTGGCTAAATACCTCCCACCACAGTGCAGGTCAAACTCTACTCGCTGGTTCGTGTCCGCCACACGGTTGAAGGTGTGCAGAATC
TCATTCGTTGCTCGAATATCCCAGCAATGGATACGTGCATCACGTCTTGCAGCCGTGAACAAAAACCTCCCACACGGAGAAAACTTCACTTGAGAGATCC
CACGGCCATCATGGTCACGCAGTGCCAGCAGTTCTACTCCTTCATCCTCCGTGTATACACAAGTAGTGCCTCCATACGACCCAGCTGCGTAAATCTTGGA
GTGATCTGGATTAA