Description :
From Genome Similarity Track
Location :
contig_27:183706- 184742
Transcript NameFunction/comments
g6963.t1ETK91253.1 hypothetical protein L915_05130 [Phytophthora parasitica

Sequence
1036 bases(100 bases per row)
TAAAAGAAAGACTGAGTGATGAATCCTCCCAAACAAACCCTGAGGTATCAACCGATGCTGAAGTAAATATTCGTCCCGTTATGATGGTTGCTGAAGTACA
GGTACGCCCCGATACAACTGATAGAGGATTTCAAGCACGTCCTGATACAGTTGAAAAGGGATTTCAAGTACGTTCCGATTCAACTGATCGAAACGTTCAG
GCCCGCCCAACGACATCAGATGTTGGGGTTGGTGAGGAGGATAAGGCAACAGTCGATGATACAGATGATATTTTGCTCAGTGATGATGGCAATGATGAAA
TAGATGAGCAGAAGCGATCAAAACAAGCAGTTGCAGAAATATTTGAGGTTTATCCTATTCTTGCAGATTTGGGTATTCATCCCGTCGCTGCTAATGGACG
TCAGCTAATGAAGTATTATATTAGAAATGGAGCAAAGACATACAGTGTTAGATTGAACAAGCTTGGTTTAGTTCCAAGCATCAATTGGTCAGATACATAC
GACCATATCGGTGTGGTACTAACTAATGACGCTCGATTTCTCAATTACATCAATGAGAAACGAGAACGTAATGAAATGGGTGAAGAGGATAAAATGGCAC
CGTTTCAAGTATGGCAGCGTATTGGATCCAAAAGAGCCAACGCTTCTTCTGGTGAGGACTATAAGCAAAGCAAACAGAGACTTGAGGATAGCTTTCTCTT
CGATCATTCAACTTCCACAACTTCCGATCAGACTTAGAACAAATTCAAAATGCACTCGATCATTGATAAAAATAAGGAACTACTTGAATCGAACAATTTA
TTATAGAAAACTGTTCCTATCCTTAAAGGAACCAACAAAGCAACTCCTTTTGATGCGAATGGTATGTATGGATCGATGGTAGTACAATTGGCGTTTTCGG
CAAGGAAAGTAATAAAATCAAGCCCTCTATAACTAAGAAAGTCAATTGGCAACTTACGCTTAAATCATTTGTAGATATGGTCAGATCGAAAGGACTTGAC
TTAGAGATGCTTGGTGATGTGGATAAAGAACTTGAT