Description :
From Genome Similarity Track
Location :
Scaffold_1820:1837- 3118
Transcript NameFunction/comments
Phyag_g11549hypothetical protein PHYSODRAFT_525302

Sequence
1281 bases(100 bases per row)
CGATGGCATGCCTCCGGAGATCTGGGACGACATGGTTCAGCACGAGAAGTTCATCTACTTCTCGCTCATGTTCCTCAACGGATCCGTGCTTTGGGCCTAC
TACTCGTGCCTCAGCGCCCAGGACTTTTACGTGGTCGAGTTCCCGGACTCCGGCCTCGACTTCTCCTTCCTGACAACCCTGTGCACGGCCTGGCCCATGG
TCATCGGTCAGGGGCTTCAGATGGTCTTCGGACTCGACAAGAAGTTTAGCCAACGCACCCGCGTGCACGTGGGCTACGGCATCTTCATGCTCATGGCCAT
CCTCATCATGATCTTCAGTGCCATCAACTTCTCCAACCAAAAGACGGGCGGCATCCTCGTGCTCGTGTGCTTCGGGTGCATCGGGTTCGGCAATTCGCTG
TCCGAAGCCACATACTACACGTTCGCCGCCCTCTTCCCGATCGAGAAATTCACCAACGGCGTACAGATCGGCAACACGTGCGCCGGCATCCTCAACATCA
CAGTGGCCacggtgctgcgtctcgccGTAGGAGGCGTGAAccagaccagcagctccacgaagcTGAGCTTCTATCTGTTCTTTAGTCTGTTGGTCGTTGT
CCTCATTTGCGCCATCTTGCTGTACCGTTACTTGGTAAGTCTGCCGTCCGTCAAGTTCCTAATGGACCGCAACGAACTATCGGCCAAGGAGGAACATCTA
GCGAACCAGTCGGTCGGCCGTACACTCAAGAACCTGGGCcgcatcttcagcatcatctGGATCCCGGCCTTGGCGCAgttcctcatcttcttcgtgtcgC
TCTCGGTGTTCCCGGGCTTCGGTTGCGCCGCGTCGAGGAACCTGGCCCCGCCgtacagcgacgaagaccaTACGCTCACGGCGACCTGGTACTGCGCccc
cggcatcgtcggcAGCTACAATTACGGCGACTTCATCGGTCGGGTCTTGTGTACGGCTGCGGTGTACCGAGTGGTGACAATGGGGTGGGCGTTCGGTCTC
TCCATTCTGCGTCTGGCCTTCatcccgctgctgctcatgggcgTCGCTGGCACCTCGCTGTACGCGTTTCCGTACGGCAGCATGGGCGCGTtggccttca
acatcgtACTGAACCTGCTCATCGGCATCTCTACTGGTCTGCTGTCGACGGTCACCATGGGCGTGGCGCCGCGCATGTTGAAGCCGGAGGACCGCGAATC
GGGCGGCGCCGTCATGGTCTTCTTCCTATTCCTGGGCATCGCTGGCGGCTCCACGTTCGGCTTCCTCGTCAGCGACAATGG