Description :
From Genome Similarity Track
Location :
Scaffold_731:18367- 21670
Transcript NameFunction/comments
Phypl_g10620hypothetical protein PHYSODRAFT_254379
Phypl_g1062112-oxophytodienoate reductase, putative
Phypl_g1062212-oxophytodienoate reductase, putative

Sequence
3303 bases(100 bases per row)
AGTGCCGATGGCCATCGCAGCGGTCCGGGAAGTGGTGGCccacgacgagcgcttcgcgaACGGATACATCTTCCTTGGCCACTCGCAAGGAGCGATGATG
GCTCGCGCGGtgatcgaggagatgaacGACCACAAGGTGCACACGTTCGTGAGCCTGGCAGGCGGAGTGAACGGCATTTTCTACGGACCCCAGGAGGCTG
ATCGCAACTCGATCCACGACTTGGGAGCTGGATtcggcgctgcagtgctACCGCAGAACTTGTTCGACTTCACGGGTTACGCGCCTGAGGGATACCGCGG
CAAGATGCAGGCCGACTTCGCTCGTCGATCCATGGACGCGAAGATTCAAGCTGCGTACTCGATCACGAATTTGCTGCGGACGCCTGTGCGCGACGTGTGG
CTGGCTACGAACCAGTTCCTCCCGATGGTCAACAACGTGAACACGTGCGCGTGGTTTGACTTCCACTGCCACGTGGAGAAGATCCGCCGCAAAAACAATT
TtctgaagctgaaggaggcgcaCTACTTCGCTTCTCCCGAGGATGGCGTGGCGTCGCCATGGCAAGCAAGTCACCTGGGACACTACAGCGACGTGAATTC
ACTGGAAGAGATCGAGTCGAAGTTTGAGAGTTTGTCGATCGTGGAGATGCACGATACGGTTGAGTACAAGGAAGACACCTACGGCCTCCGCACGCTGGAC
GAACGTGGAGCACTGTTCCGTTACACGGCCCCGGGGGTTCCtcattgctgctggctgtaCGACTTTCCAAAGTTCCACACGGAGGGATTGTGCGAGTTCC
ATCCTCTCTACGACAAGTACGTGTACGACGTGCTTTGGTAGGGCGTATATTGCTCGCAGCTCACTCATACGAGTAGTATATATATTCAAGGATAGGGCTC
TGAAAGTGGTGCTGAGACTTCTTCTCCCcgctgccatcgccactTCATCGATCTCCTCTACGTTCCCCCGTGATGATGTTTGATAGCGCCACCAGTGTCA
TGATCCGAGTGAAAACGTTTACGTGTTCCCACCAGAAATTCGAAAGCGTGCTCTTCCTTCAAAGCTGGGGAGCTACGGATCTTAAAGCTAAGCGGGTTTC
ATTGAATTGACTATAGCTCTAGTCTTACTCCTTCTGCGTCAGGAACGGGTAGTCCGTGTAGCCGGACTCGAGTGGCACGCCCGGTTGCGGGTAGAACGTC
TTCACATTCGGCGTGTTGAGCTCCGCACCGACACGCAGCCGCTCCACGAGGTCCGGGCTCGCGATGAAGTCGCGCCCGAAAGCAACgaggtcagcagcgc
cttcttcaaccGTCTTGAACGCGTCGTCACGGTCGTAGCCGGCAGCAGTGAGCAGGACACCCTTGTACGTGTCGCGGAAGTGGCGAGTGACACCAACCTC
CGGCACTTGGACGTTGGCCGCGTGCATGCCACGACGCTCGATCACGTGTACGTAGGCGAGGTCGTAGTCGTTGAGCTTGTTCACGACGTAGCCGTACGTC
TCGGTCGGCGTCGAGTCCTTGCAGCCGAAGGTATTGCCGTACGGTGACAAGCGGATCCCCACCTGGCTCGAGGGCAGACTGGACAAGATgacctccacca
cctcgaagaTGATGCGGGCGCGGTTCTCAATGCTGCCTCCGTACGTGTCCGTGCGCTTGTTGACGCCGTCGCACAGGAACTGCTCGAGGAAGTAGCCGTT
GGCCGCGTGGATCTCCACGCCGTCAAAGCCCGCGGCAATGGCGTTCTCTGCGGCGCGCTTGTAGTCGGTGACAATACTCGGGATCTCCTCAATCTCCACA
GCACGCGGGGTGACGTAGTCCTTGCGACCCTCGCGAGTAACCGCATGTGAGTGAACATCGTCGAcgctcgtcgcgctcgacgaAATGGGGAGCTGTCCGT
CAGGCTGGTTCAGTGGATGGCCGACGCGTCCTGTGTGCCAAAGCTGCACGAAGATCTTGCCGCCCTTGTCGTGCACGGCCTTCGTCACGGCCTCCCAGCC
GTCGACTTGGGCCTGGTCAAAGATTCCCGGAGCGCCGAAGTATCCGCGCGCTGTCGGGCTGATGTTGGTGGCCTCGGCGATGAGCAGACCACCGTCAGTA
GCACGCTGCGCATAGTGTTCGGCCACAAGTGGAGTGGGCACACCACTCTCGCCCGTACGCACGCGCGTCAATGGGGCCATGACGACAcggtgcttgagct
cgacggGGGCTTTCTTGCCGCCCAACTTGAAAGGCGTGAAGAGCTTCGGGACGATAGCGGAGACCATGGTCGGTTTTGACTTGTGTTTGGAGCTTTGGCC
CTTGGAGTGCGAATTGAAGAGTGAGGTCAAGTGAGCTCGATGCATATCCGCTCATTGTCCTCGATGTCATTTCCTGTGCCAGCTACACTGTACTGACCAT
TGTGACGGCTGTCCACGTCATCGTGAGACCACTAAACAAAGCGCACAACGCAAACTCGCTTCAACCTGCATTCTTTTGGGGCGTAGCCGTAGCGCATGGC
TACAGTACGCGAGAGCTCTAGGGCGAATGTGGCTCAGCGTCACTCTTTGACCGAAGGTGGTGCCTTCGTCTTGCAGGAAACCCTACGCAGCGCCTTCCTT
ATTCAAATCAACAAACTTTCGCGTTTGTTGATGCACTGAGTGATGACGACCAGGGCTTTACGAGTACAACCGATGTGCGCTTGTGTGGAATGGGGCGCAA
CCAGCTGTAAACTGCGCAGCAAAAATCAAGGAATGAAGTCCATACTTGCTTTACTATCCGTACGGCATCACCTCCGGCTGCAAGGACTCGACGCCGACCG
AGACGTACGGCTACGTCGTGAACAAGCTCAACGACTACGACCTCGCCTACGTACACGTGATCGAGCGTCGTGGCATGCACGCGGCCAACGTCCAAGTGCC
GGAGGTTGGTGTCACTCGCCACTTCCGCGACACGTACAAGGGTGTCCTGCTCACTGCTGCCGGCTACGACCGTGACGACGCATTCAAGACggttgaagaa
ggcgctgctgacctcGTTGCTTTCGGGCGCGACTTCATCGCGAGCCCGGACCTCGTGGAGCGGCTGCGTGTCGGTGCGGAGCTCAACACGCCGAATGTGA
AGACGTTCTACCCGCAACCGGGCGTGCCACTCGAGTCCGGCTACACGGACTACCCGTTCCTGACGCAGAAGGAGTAAGGAAGACCAGGAGATTGTCTTCT
TGTCCCTGGGTCCTTTCGAGCCCGAGGAGCTTTCGTGGTCAGCGGACAACGATGCAGCGTCGAGATACACGTCGTTGCCGAGAGGAAGCGTAGAGGAGAT
CGA