Description :
From Genome Similarity Track
Location :
scaffold_582:18366- 20632
Sequence
2266 bases(100 bases per row)
TACCAGTACATTGATCACTGCGATTTGTAATGCAGATCAATATCGCCCTATTGATCTGCATTACATTCTGCAAGCACGTGTTTCGTCTGGTTGCATGCGT
CTGTGGTGCGATGGGATTCCCATCGCGCCATCATAGGAAGGGCTGCTCCGGCAGGAATAATCGCGTTCGAGCACCAGAAGGCTCCCAATCGCACAGTGCA
TTCCTGTCTCGCATGGTGATTCAGCCGCTGAATTTCAGGGTGCGGCTGAGTGGCCCTGTTCTCAATTAAACTTTTGACAGGTAAGCTTCACACGTGCTTC
ATCGCGATGGGGTCTTTCATCAGTGACCACCAATTACCTCGATGCCGTTTTCCGGTCGTCAACGACGAAGGACACACTACTGAGACATCGAACACCAAGT
TTATTTATCGATGGAGTCACACAAGAAATATGCTTCTATCTCACGACTATGGGAATGCTTCATGGTTTGGCTGGTTATTCACCTACGCGCTTGTGCTATT
CTTCTTCTCGGCCAGCCGTTGCTTAGCCCTCGGCGAATTGGTTGCAATGTACAGTAGTCCCAGGGATAATACCATCGACGTGAAGATTGCCGCCCTCGGA
CTTGGATTCATGGAGGACTTCGTTTGTGCAACGTACTTCTTGTGTGCACTATGGCTATTCGATACCTTGATGGAAGCGGTTAGCAAACGGTTTGACTCTA
AAAGGTGGCAGCAAAGCTGCGTGACCTCCGGGACTGTCAAGAAAATCGCCACGTTTGCGGTATCGTGGCTGCTCTTCTTCGCCATGATGCTTCCTTTCGT
TGCGGACTTGGTACTTGTTGTTAATCGCGAGATGCGATTTACGTTCGATCTCGTTACTATGGCTATCAGCGAGAAAGAGTTTGTTGGTGCTGCCCCAATA
TCCACCGAGGAGATCCAACGAGGTTGTATTGCTACAACCCTTCTAATGATTGTCAGTGTGCTATTTGCTTCTGTTCGTGTGAAGACAAGGTGGGCTGACC
TAACGATCTGGAATCCAACCCACCTGGTGATGGAATTTGTAGCATGTAGCGGTAAGATGATCACCAAGAAAGCGAACGGAATCAAATATGTGGAAGTCGC
TCTTGAAGAAGGCGTCGACACCGAAAACGGTGATAAGTTGTCATCTGGAAAAGAAAACCGCGCCTATCAGAAGCTCGTTTACCACCATGCTTTGCGGGTC
GCGGTCATCCTCATGGGTCTCATTGTCGTACCTGCTGCTGTTGTGGCGTTGCGTTGTGCTTGTTCACCTTTAGTTGCGTATGTTGGCATGAACGCGACAC
TCAATGAGCTGTTTGCCCATGCCTTCCAGCCTACTCCATCAGAGGCGACATTTACAAACATGAAGGGAGGTCAGCCTTGGGTTGAGGTGTTTATCCATCC
AACTGAGAAGCACGAACTTTTTGGAGATAATTCGCTATACCGACGCACCACAGGCTTCCAGGGAGACCTTGCTTTCGACGTTGACATCAGCAAGGATAGC
CCGCCCAACGTTTTAGTGATTGGAGTTGAGTCTTTTAGATTCCAAGACTCACGCTACCTTGTCGGAGAAGATGATCCGTCCAACTTGTTCAAGGGCGCCA
ACATGACCATCACACCCAACTTTGACAGGTGGGCCAAGCGCGGGGTTGCGCTTCGCAATTTATGGTCGAGTACACCCACAAGTCGTTCTTTGGAGAGTCT
CTTGTTTGCACAGGTCCCGTACGATAGTACTTTGAGGACAGGAATTACTGGAGGGAGGAAGAAAACAAAGCTATCTGGATTACCACAGCTCTTCAAAGCC
AAGGGGTATGAAAATTTCTTCACGACTGGATGCCCGACTCGGTTTGAGAATTGGAACGTATTCCTTCCGGCTCATGGCTACGATGTTGTGTTGGAATCTA
AAGAAATGGTTCGTCTGGCTGAAAGCAGACTCGGGATTACTCGCGACCAATGGTTTGGAGAGGAACAGCGCGGATTTAAATGGGGCGTCCACGACGACAT
TAACTTGCAACTACTAGGTGACATGCTCATCGACAAGACGAATGAACAGAAGGATGAAAGAGCAAAAGGTTTTCCGAAAAAGCCGTTGTTTGTGACGCAC
TACACAATCTCCAGCCACGCACCTTTCAAAGCACGTCCGACATGGTATGCGAATGCCGATAAGCCCGATTTCTCTGCGCTTTATGAAGGCGAGAAGAACG
CGCAAAATATCAAGAACTACCTTGAGATGCGGTATTTCACCGACGTGCATCTGGGAAAATTTATGG