Description :
From Genome Similarity Track
Location :
contig_27:183656- 184692
Transcript NameFunction/comments
g7297.t1hypothetical protein

Sequence
1036 bases(100 bases per row)
TATTGATCAGGTTGTGGCTCAGTCAGACTTAAAAGAAAGACTGAGTGATGAATCCTCCCAAACAAACCCTGAGGTATCAACCGATGCTGAAGTAAATATT
CGTCCCGTTATGATGGATGCTGAAGTACAGGTACGCCCCGATACAACTGATAGAGGATTTCAAGCACGTCCTGATACAGTTGAAAAGGGATTTCAAGTAC
GTTCCGATTCAACTGATCGAAACGTTCAGGCCCGCCCAACGACATCAGATGTTGGGGTTGGTGAGGAGGATAAGGCAACAGTCGATGATACAGATGATAT
TTTGCTCAGTGATGATGGCAATGATGAAATAGATGAGCAGAAGCGATCAAAACAAGCAGTTGCAGAAATATTTGAGGTTTATCCTATTCTTGCAGATTTG
GGTATTCATCCCGTCGCTGCTAATGGACGTCAGCTAATGAAGTATTATATTAGAAATGGAGCAAAGACATACAGTGTTAGATTGAACAAGCTTGGTTTAG
TTCCAAGCATCAATTGGTCAGATACATACGACCATATCGGTGTGGTACTAACTAATGACGCTCGATTTCTCAATTACATCAATGAGAAACGAGAACGTAA
TGAAATGGGTGAAGAGGATAAAATGGCACCGTTTCAAGTATGGCAGCGTATTGGATCCAAAAGAGCCAACGCTTCTTCTGGTGAGGACTATAAGCAAAGC
AAACAGAGACTTGAGGATAGCTTTCTCTTCGATCATTCAACTTCCACAACTTCCGATCAGACTTAGAACAAATTCAAAATGCACTCGATCATTGATAAAA
ATAAGGAACTACTTGAATCGAACAATTTATTATAGAAAACTGTTCCTATCCTTAAAGGAACCAACAAAGCAACTCCTTTTGATGCGAATGGTATGTATGG
ATCGATGGTAGTACAATTGGCGTTTTCGGCAAGGAAAGTAATAAAATCAAGCCCTCTATAACTAAGAAAGTCAATTGGCAACTTACGCTTAAATCATTTG
TAGATATGGTCAGATCGAAAGGACTTGACTTAGAGA