Description :
From Genome Similarity Track
Location :
Scaffold_28:183648- 185327
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_06849predicted protein

Sequence
1679 bases(100 bases per row)
TAAATGTCACTGGTTCTGTGGACAATATCTGTGCACTCTATTGCCGTTGCAAGTTTCTAGCAGCGTTCCAGGGTACCGCTTGTGTCGTCCATAACGTATG
AGCCGGTTGCGCTGTCGTCCTGTCTAGGCGATCGCGCACGAATCAGAAGCCGGATGCCAAAGAGGCGAGGAGGATGGCTGTTCAAGATCTGCACCCGTAC
CTGGTACCTGGTGGAGCAAGGATCGACACAGTGTACTACAGGCAGCGAGCCATCGTAGTCGTTGCATGTATCGTCATCCACAACAGCGATGTATGGGCGA
TGCGCGTGTGCTAAACAGCACGAGCAAGCCATCTACACTGTACGACTCGCACGACGTTGGATTGTCGTTCTAGTTACCGTGGAATAAAACTTGGACGATG
GCGCACGTGAGGTGAGTGGCGCCATCCCCAGCACATCGTTCTCCGATCCAATACGCACGCGACACAAGAGAGGTACACCACGAAGGGCTCGACGTTGTTC
CTACGCCAGCGCTTCACCAATACTCAAGATGGATGGCGACGCGGGCTGTGTCATGGCCACAACCACGGCGGTGGCTGCAATCACCTGCACCTGTATTTTT
GGCGAAACCGACGCTAGAGACACCAACCTTGAGGTTGCATTTTCCTTGGCGACTCAGTTCAACAAGCTGGTGCGCGTGTCTGCGGCGTTGTCGCTCCTCC
GACATCCCATCGTCGCCCAGGTTCGTCTACTACAGGGTACACTTGCACAACCCTATATCTCTGGTACCCTCTCAAGACTTGCACGGTACGCTGCGTCTCG
AAGGAGCGCGGTGTAGTTCTTAGTAGGCCAGCGAACCTGGAATTTGAAGCTGCTTTTAAATTGGTGCATAGTCCGCATAGAGCTCCGCATAGGCTAGGAC
GTGATGGCAACCGTACGTGCCTACGTTCCCGATTCCATCGTTCTCCTCAAGGATTGTCCGATGAGCGTGGACAAGCGTGCAGCAACACTGCTCGTCCATG
ATACGCAAATAGTGTATATCAGCAAAGCCGGAGCCGCACCCGGAGTTACCATTCGGATACTGCTGATGGTAACCGGAGATCGCCGTATGCAATAATATGA
ACTCGGCGGTGCTGACGGTGGCCGACCTCGGCGACGACGTCGGCGACATCTACGCCTGGATCGACGCGCAAGTGAGCGTCGCGCCGGGCGACCCCAAGGC
GCACCTTGAGAGCCTCCTCCCGCAGTTCCACGTGCTTTCGCAGGAGCTCAGTGCCAACCTGCAGCAATGCCTCGAGACCTTTCCGTCTTTTGTGAACCAC
GTCCAGCTGCTCCAGCTCAAGACGCAGACGCTGGGGCAGAGCTTGCATACGCGTAGCCCGAGTACGACGTGCGCGCGCGGTATGTACTACGCTCTGGCCT
AGCACTACTACTGCGTGCATGCTCTAGGCGACGCGACGCCTGCCTACAACACGCTCTCGCAGCTGCATACGGCCAAGACGCACATGCAGCAGTGCTCGAA
CGCACTACAGGAGAGCGCAGCATGGAAGCAGCATAGCCGATACGTCGTACAGGCAACCACCGATCCAACGCTCGACTTGGCCAAGCTGGCGACGCATCTC
GCTGCCATGCACAAGAGCCTCGAGACTCTCCAGCGCATGCCGGGCCACGACGAGCGAGCCGCCACCATGGATACGTACA