Description :
From Genome Similarity Track
Location :
Scaffold_581:18363- 21267
Transcript NameFunction/comments
g17247.t1hypothetical protein

Sequence
2904 bases(100 bases per row)
ATGTTTGGGGACATGGCCTCAGCACGGCTGGATCAGTGGTACGCATCTCCCGATCTTGCACCTTGGGTGGCCGACGTGGAAGTATGCCACCCGGGCGCGA
GAGCGGACCACCGTGCGGTGCGGCTGCAGTTGGTCAGCCCATCGGACCCGATACGCATAAAGAAGCCGGCGCGGGTTTACCCACCTCCGACCATTGCAGA
GGAATCTGTGCAAGACGCGATGAAGGCTCGCATTACAGCCTCCCACACCCGATTGATCGATGAAAATATGGATGCTACCTTGATGGCGTCGGCCTGGGAA
AAATTCAAGGTGGAGTTGCGCAAAGAAGCCCTGTCCATCATCAAACATCGGAGGAAGGCGGCCAAGGCAACCTACAAGCAAAAATCTAGGCACCTTTTGC
GGCAAGAGCGGCGCCTCCTTGCGGAGGCAGCGGGGGCCAACACACGGTGGAATCGAACACGGACATGCTGGCAGCGTTATCATTGCAAGATGGTGTTGGA
GATACATGTCGTGTAGGAACACGCAGAAAATCTCACTACCGAACGGTATGAGTCCCACCACCAACACACGCTTCCCTCGCGAAAGGTCAGCGAACGTTGG
ATCAACACCTGAAGACCAGGAACGATCCCTTACACCGGATTGGTTGTAAGCGCCTCTGTATACCAAGGTTGAGTTCGGTCAACCTTAAAACCTGCACTAC
TAGCCACGAACGAGGACTAGAATGCAATATTGCGCTTTCGCGCGAACCCCCGCAGTCCCTCAGAAGTAAGGGTACCGGCAGTCACGCCTAATACGGGTTT
GCCGAGGGTAACCTCGGCGGGTAGTGAAATACACTTGGGAACACTCGGGTTCCACCAATATATATAGGGACCGACACTCTCCGTCGTCCCTAACTCTCGG
CCACTCCTATCTCTTGGACTGACCAGCAACAAACTCTCGGTTCAATGTACCTCAAGCTCGCTGACAGGCATCCCACGCAGCCGAGCGTATCCAGACCCTA
AGACAAGCTAGATAGACTTACCGAAGACGGACTTGACCCTTGGTGGCTTGTGGGGAAGACTGCTGATTTATTTCTTCTTATCCTACAGCTCTGGGAGCCT
CTGTAGGTCATCATTTGGCTAGTCCTATATCTCTATACAAATATCAAGTGTAAACAGATCTCTGTGGGAAATCGTATAGCCGGCTCTACACAGCCGAGGG
TACGACACCGAAGTGGGTACAAACGAGGTTTTTAACCTCGGCCGGGGTTTTATTAGACCCAGCCGAGACCTCGGTCACTATTGTTCCTAGGTCACTATAG
CGCGGTAAATGAGACCAGCCAATCAAGACACTCTGTCGCCGTTCACTGAAAGGTGCAACGTCCGCCGGACCTTGACTGTTCGGCTCCAAAACCCAACGCC
ACAACTGCCCCCGCCTCGACGCAAGCTCCCGCAAGTAGTGCGCGTCGCGGCGCCTATTGATCGCACCCCGATGGCTCGCCGCTCGCCGTTGATGAGCCGA
GCTACGGCCGCCGCTCCTCATGCTCTCGACACCTCCGAAGAGGTTCGTTTCCTGTCTCTCTTTCCGTCTTCATGCTCCTCGAACCTTGTTTGACCGCCTC
CACGTTCACAGGAAGCTAGCGGCACTCCGTCCGCTACTTCTGGCTCCGCTGGAGCATCGGTGACCGTTCCTCGGTCGCCGGCTGCCACTCCTCTGGCTGC
GGGCGAGGGTGCAGAGGGTTCGTCCCCACCCACGCCTCCGTCGGCTTTGGTGACGACCCCATTGGCTGCCCAAGCTTCTGTCGCTCGTGTCCCCGATCAG
CCGAGGGTGGAGGAGAAAGGTGAAGACACTTCCGAGCATTCTCGAAGTCGCACTCCCGCTTCGGCAGCAGACAGCGAGTTGGCCGCTCTTCAAGGGTCGA
ATTTGGATGTTTTGGCCGACATCGCGTCGACACCTGAGGTCTAGGCTTCGGTCTGGCCTCATCCATTTTCCACGTTCGTTCCTCAAGCTGCCAGTGTGCC
GTCCGAAGCCTGTAGTCATCCGTAGCGGCAGTTCTTGAGCTCCAAGTAATTCCATTTAATCCAATTCCATTCGAAAATCGTTCACGTCACATGTAAATAT
GCAAATTCGATGCAGTAGCAGTTTTCGTCTGTCACTGCGGGCTGCATCATCCCCGCAGGCAGTTCATTCGTCAACCGACGTCGCAACCAGGCCTCGTCCG
AGGCTTGGTAGCCATCAATAGTCGGTCACTCGCAATTTTGATACAGTAGCAAATTTCATCTGTTGCTACGGGCTGTATCACCCCCGTAGACAGTTCAACT
CTCGGTAGCTCTCCAGATTAGTTCTCATCAGCAACTTGAACCATCTGCAATCGCCGTTCGCTGCGCCGAGTCCGCAGATAATCATAAAGTAGCCCGCCAC
ATGATAAATTTGAGGCAGGCTCCCACGTGGGCTCATCATACCCAATCCACTTCACCTTGAACTCTCGGACAGAGCGGCTAGTGCCCGTCGACAGCGGGGA
TCGGTCATCGAGGATGGCTTCTACCTCATATTCGCCAGCGAGCTGGTCTGGCTCCCAGCTATCTTCAGGCAACAACTCCTCGTCGAAGTCCAGTCTCGTA
TCCTCGGTCACTTCAGGTGCTAACCGACTCTTCGGTCGGTCTCCAAATTCGCCGACGGCCTTGAGTCGGGACACGTGCACCACCGGGTAGAACCTATACC
CACTTCGGTCTGGTAATTCCAACTCGTACGCAAACTCTTCGATCTTTTTCTTGATCCTGAATGGCCCATGCCATCGGTGGGCCAGTTTCTTGGTCAACCC
TGGCTTGACTCGTTCCATATACAACCAAACTCTGCTTCCGGGTTGGAACAGAGACCTCGGTCCTTCGTCAGTGGGATCAGATGTTGCCCCCGTCTCCACC
TGTG