Description :
From Genome Similarity Track
Location :
scaffold_68:18359- 22948
Transcript NameFunction/comments
g2640.t1 Major Facilitator Superfamily (MFS)
g2641.t1 hypothetical protein PHYSODRAFT_506618
g2642.t1 BolA-like protein

Sequence
4589 bases(100 bases per row)
CCGAAATGCCGAGTTCTCCCACGAAAGCCTTGCGTCTCACTTGAGGTAAGGCGAGTCACCTTACCTAGAGTGGCTGACGCCATGACATTCCTGAGCGCGA
TGCATCCCACGACCAGCAAAGGCCCGCGAGGAACTTCAACCACCGCCATCTTTTCGTTGATGATTTGTAGACGTGTTAAACCGCGTTGGTACATGACATG
ACATTCGGCCGCTCGGTCAACGAGCTTCTGCACCACCGCAACGACGTCTTTCGGTCATACGAGTGTATGCGTTTAGACTGCAACATGAACGCCTTGATCC
CCAGTGGGTCGTCTGAGCCGGACGCGGGGCGCTTCTGAAGTAGCTATCTCACTATCTTCAGACTTCAGACGTCTTCGACTGTCAAGGCATTTGAAGCATC
CCGACGGCCCACACGCGGCAGACTTGGTTGAAGCGGTACGAGATGAGCCGACCGACCTCCGATTTGTCAAATCCGGACGCTGATGTTCAACTGCGCTCAC
ATGCATCGTCATCGTTTTGATGGATCCATTCTGCAACATTGAGCTAAGCTAAGGTTATTGTACAGCCTGCTGTCGATGGTCAAACCCCGAAAGAAGTCAC
ACGTCGTCTCATTCTGACTTTTGCGTCTTAGTGCCGAAGCAACCGCCGTAAAACAACTCCTATCCCTTCACGTTTTACCATGACCGTGGCGATACCAATT
CATCGCCACACAATGGACACGGAACCCACCGACGGCAGTCGCACCTACGCTATCATTGTCTGCGCGTTCGCATCGCTTGGTGGCTTCTTCTTCGGCTACG
ATCAGGGCGTCACATCCGGTGTCCTGATCATGGACTCGTTCCTGAACGACTACTGTGTCGGATGGCATAACTTCACCTATGAGGAATGCACACGCTCCAC
CTCCGACCTCCCCGGGGAGTGGACGACCTTCACTGTCTGGTACAACATGGTCTACAACCTCGGCTGTCTTGTGGGTGCTCTCATCGGCGGCTACGTTGCT
GATAGGTTCGGCCGTCGAGCTACGATCTTCTCCGCTGGCGTTCTGTTCTGCATTGGAACGACTTGGGTGTGCTTAAACCCCGCACAGGACCACACGCTCA
TGTACATCGCACGCATCGTGCAGGGCTTCGGCGTTGGGAATTCATCGTTCTCGCTCCCGTTATTCGGCTCCGAAATGGCCCCGAAAGAGCTTCGCGCACG
TCTGTCAGGCTTGATGGTGTTCCCTGTCACGTTCGGCCAATGGCTCGCCAACCTCGTCAACATCCTTGTGGAGAACGACGACAAAGGATGGCGCATCAGT
AATGCCGTGTCCATGATCCCTCCCGTTATCGTGCTTTGTGGCATCTTCTGCGTGCCTGAGAGTCCTCGTTGGACGTACCAGCAGAAGGGCAAGGAGAAGG
CTGAAGCTGTTCTCAAGCGTCTTCGTCAAACCGACAACGTTCACCATGAACTTGAAGCTATCGGCGACCAAATCGCCCAGGAGGAATCTGAGGGTCTCGG
ACTCAAGGAGCTCTGGGAGCCTTCGATCCGCAAGCGCGTCTTTATCGCCATGGTCTTCCAGCTCGGACAACAGGCTACCGGTATCAACCCCATCATGACC
TACGGCTCACTTATCTTCAAGGACATTACCGGTGCCGGTATCTACGCGTCGCTTCTATTGAGTGGTGTGAACTGCTTGAGCACGATGCCCGGCTTGTTCA
TGTTGGACAAGTTTGGTCGTCGTCAAATGGCGTTGATCGGAGCCTGCGGGATGTTCATTGGCCATCTTTTCGCCGCGATCCTGTTCACGGTGATCTGCGA
CGGCAACGTCGATGACTCTGGCTGTCCTGAGGTTGGAGGCTGGTTCATTTGTATTGGCACAGCGTTCTTCGTCTTCAGCTACGCCGTGTCGTGGGGTGCC
GTGCCCTGGATCTACTGCTCGGAGATCTTCCCAATGAACGTTCGAGCGACTGCCGTGTCCCTCTCAACTGCAGCCAACTGGGTCGGAGGCGCGCTAATGA
CGGAGATCGTCAAGCTGTTCCCGTACATGAACATCAACGGCGTCTTCTTCCTGTTCGCAGGGCTCAGTGTGGGCTGCGGTGTGTTCGTGTACTACTTCTG
CCCGGAGACCAAGGGCCTTTTGCTTGAGGACATCGAAGAGCTCTTCCATCCACGTACCAGCGCCAAGTCGCCCGCTTACGTTGAAGCCAAATCCCCAGTC
ATTGTGGCGTAGGAGTGTAAAAAGACTCGTGTACTGCTGGTATGGTGAAGTGCTCACTCTGTCCGCCATCATGCGGAGAGTGCAGTGCTAGAGTCGACTG
TCCATTTCTTTTCTAAAATGTTAACAAACGTGAACTGTTCCCTAAACTTGCCAATTGCTTACGTAAAGATCGTGCAACTTCAACTTGACGGTTTGGTCCG
ATGTCCCGGCTATGAAAGGTACCAAATCACAATTGGGCCACTTACAAACTTCAAGTCAACGGGACTAAACGCCCTGTCCCATGCAGTCCCGGCTGTGTCC
AAAACCCGGCTAATCAGGGCCAACTTCCTAATTGGCACCTAAATAGTGTTCCACACACAATGGAGATGGCAAGGCTTGTCGATCGATCATTTACTGCGGT
GCGCAATGTCCGAAGATCAGCGCCGCACCGAGGACTATTTCCTCAAGACATCGCAGCCCAAATGGGCGGACGAGCGTCGTGAACAAGTAGAGGCTTTCCT
GGATCACCACCGCGTCGTGGGTAAATGCGTAGCGGTCGTGACGTCCGGCGGTACAACCGTCCCGCTGGAGCGCAATACTGTGCGCTTCCTTGACAATTTC
TCCACTGGATCCAGAGGCGCTGCGTCGGTCGAGTACCTGCTGGGACTGGGCTACGCGGTCATCTATGTGCACCGTCCAGGGTCGATTGCCCCCTTTGCCA
GACACCTGCAGCGAGCCACGTGTTCGTCGCTGGACGTGGACTTCCTGCAGCACGTGGACGTGTCCACCCGCAACGTCCAAGAGCAGCAGATCCGCGTGCT
GGTAGAAGACCCTACAGCCAAGAAGAACGTGGTTGACGCAGTGAACAAACTTCGCAATGTACGTGCAACCAACACGCTGCTCTCACTGCCGTTCACCTCC
GTAGACGACTATTTTTTTGCCCTTCGGATGGTTGCGACGTGTGTAGCTCCTTGGAAGGAGCGGGCGTTGTTCCTGCTAGCAGCTGCAGTAAGCGACTTCT
ACATCCCTCAGCAGGACTTGTCGGAACACAAGATCCAGTCAAGAGCAGGTCCGTTAGAGCTGTCGCTGCAGCAGGTACCCAAGATGCTCGGCGTGTTGCG
CCATAGCTGGGCTCCACAGTCCTTTGTTGTGTCGTTCAAGCTCGAGACGGACTGGGACATCCTCCGCAAGAAGGCCAAGCAGGCGATTTCCAAGTACGCG
ATGCACCTGGTGATTGCCAATGAGCTGCATTCGCGCTTTGACGAAGTGTTGCTGATCACGGACAAGGACGAGCGCGCCATCACGCGACCGAAAGAGGAGG
CTGACATCGAGGCGGCCTTGATGGAGGCCGTTGCCCGCATGCACTACCAGTACATCGCGTCGCACGACGTCTCCGTTCCCGACGAAATCGGTCACCACGT
CTCTCGCAGGTACTTTTCCGGTTCTGGTGCCTGGAAGAAACAACTGCCAACGTCAATGCAGAACGTGCTGTCCGTAATGGAGGAGCACAAGGAGGAGATT
CTAGGCGTCGTCGTGGGCGGTTTGCTGTCCGTAATGCTCAACATGCTGCAGAACCACCTCCGTAGATCTCGCTAGACGGTATCGACCGGAATCAAAATAC
ACCGAGCGTCACTGGCCTGTGGTGATAGGCTATTTAGTCATCTACTCACTCTGGTGCTTCTTCTTGAGCCCTTCAAGGAACTCCTTCTTGCTCTCGTCCA
CTGTCATGCCACCTCGGCAGTTGGGCGACGGCTTGACGTTGGCATTGGCTTCCCACTGCTTCGGGGTCTTGCTGAGGATACTGAGTGCGTGGACGCCATC
GTCCAGTTCTTGCTGCAGCACGGTGTTGACCATGCGGTGGCGCTGGATCAGCGGCTTCCCGTCGAACTGGTCGGTTACTACCACCACCTTGAAGTGCGTC
TCGGATCCCTTTGGCACGCTGTGCATGTGGCTCTCGTTGATCACGTCCAGGTGCGCGGGCGCGAATGCTTCCAGCAACTTTTCATGGATGCGGCGCGCCA
CAGGCCCCGAGAGCGGAGTAGCGTCGGTCATGAGGAAGCGGCGGATCTTTGCAGAGAGGGACACTGAGGATTAATCACCACTGCAACACGCAGGAAGAGA
GCGATGACGAGCGCGTACCTGGCGCGAAGAGGGGAGCAATAACGAGTTCATGGCGGATTCGATTCTGATTGGCAGGAGACACGAGCGTGATTAAACAAAA
TCAGTAGTTATGCGACCCCGTCTCATATCTAAATCTAAAAAAATGATGATTGGTTGAAAATAAAGTAAGTACTTACAAATATCTAGTCAAAATCTAAATG
CCCCTATTACAAGATCGCGCCCGTCTCATGGGGAAAAAGAAAAGGTTTGCCATTTCGTCCAATAGTCATAGTCGAAAATGGACCACAGT