Description :
From Genome Similarity Track
Location :
Scaffold_125:183519- 186166
Sequence
2647 bases(100 bases per row)
ACAGATTTGCGATTGGATTTGTCTCCTGCGTAGTCAGCATCTGTCACACTCTCGATGTGTATCATCCCACGTTCGCGCTGACCAGGATTTATACGCACTT
TGAACAAAGCTATTTATCTCAAATAGCGTATGGTTCTCTTCGCAAGTTTAAGATCAGCCACAGTAGGCGCATGGGCGCGACGGGTTGCGTGGTGCACCAC
GTACGCGATGTCTGGTCTCGTGCACCGCGCAATCCAAAGCAAACTCCCCACCAAAGACTGGAAGAATTTCGCTGTCTTGTGTTCTGGTGGTCCTGGTCCA
TCTGCAGGTAATTCGGCACATTTATCGTCGGAACCAGGATATTCTGCGCCAATTGGGGCCCTCACGCTGTTCGCTTCACCAATTTGTACTTCGAAAGTAG
TTCTAGTACTTTAGGAGCTTGACACCAAGTGTACCCATCTTCTGCGTTGTACGTGACGCCCATGCCAAGAAATCGTTCAGCCGGGCTAGGTCCTTTAGCT
TCAAGCTGCTCGTACTTGCGTGAAGCCTTCTTGTTACTGCCACGCAATCAGGATTGCGTGGCAGTAACAAGAAGGTCATCCACATCAACGCCGACAAGGG
TAGTTTCGGGGCCCCCGTTTTTGTAGAATACAAGAATCCGTCAAGCTTTGCTCAAACTTAAGTTCAGTAATCTGGAATACAAGAATCCGTCAAGCTCTGC
TCAAACTTAAGTTCAGTAATCTGGCTCTTGAGATGCTAGTGCCGTAGGCGTCCTTCCTGTTTCAGGTCGTGTAAACTGCGGTCCAGCCTAAGGGCCACCT
GATCACTACGTGTCACACCAATGTCCTGCAATTCAGTTTAATTGAAACAGAGGCCTTGTGTCACGTATAGGTAAATATCGTAACCTTTTTCCACCTCGGC
CTTCACATAGGCTGAGGATACATCAAAGTAATGAGCTGGTACGCTCCATATTGCAGCCACAGCGAGAATAAACTTGGCGCTAATCAAATCCATAACCGCC
GCAAAAGCCAGGGTGTAGTCTCGACCCAAAACCTGCTCATTTCCACATGCCACCAAGCGAGCTTTGTAGCGCTCGATGGAACCATCAGAAGTACGCTTCT
TTTTGTGAACACACTTCGTATGTAACCTGTTCATACCAGATCCAAGCTTTACTGAAGCACACGTCTTGTTCTCAAGCAACGAGGTCAGCTCTTCTGCGTG
CACTTGTTTCCACATGTCAGCATCTGGGCTTTGAAGGGCTTCTGCGTAAGATTTTGGGTCCGATAGCGATGCGTAGTGACAGTTTGCGGTAGGCTCTAAT
GGCTCAATCGCGGCCAGAGCGTCAGACGTAGACATATTGTTAATCTTCGATTGCACATCAGCGTCGACCTCCGTTTGTTGAGTCGACTTGCGGCGAGTAC
ACGCCGATCTGCGTGGAGGACGTCGTGCAGGTGTACGAACACCAGGTGTGTCTCGTGGCGGTGCAACGGCAGTGTTACGTATGGCACTTGGGATGAGTGT
CTGCTGTTCACACGTGATTCGATTTAAAGATCAACGTTCGGCCTCTCTGCGCTTGGCTAGCTCTTCAAGTTCATCTCCTTCGTCATTGCGTAGAGCTTCT
CGTAGCTAAATTTCGGATCCAGAAGAGAAAGTCTCGACGTTGTGCACACGGCGAGTCGTAATGAATATTTGAGATTTTGGCAAGTAAGAATCCCTTGGTT
TCATCGTTTTTACCCACTATTATACCGGTTTCACCTCGGCGTTTTAGTGAGGTTTTATCGGGGTTCCGGAATACGGTACATGTTGAGCCAAAACCACCAC
ATCCACGATTTCTGGAGGTTTATTCAGCAGCATCTTAATCGGAGATTTTCTCCCAGGGTTACCTTTGGTAGGCGTACGGTTGAGCACGTAGGCCGCATAC
TGTGAAGCCCCAGAAATTCGATGGGAGAACACTTGAACAGAACATGCATCGGACCATATTCAATATCGTCCGATGCATGCGGTCTGCCTTGCCATTTCCG
GCCTGATTTCGCGCTTCAGTTCTTTGCCTGACTACGCCTGTGCTGTAGCAGAATAAATCCACGTTATTGTATTCAGCTCCGCTATTCGTGCGCAGCACAT
AGACCTGGCAATCAGAACGTTTCTCAAACCAAACTAGAAAATGCGTGAACATGTTCGCGGCCTTGTCTTTCGTAGCAGCCAAGAATACGCGACAGTAGTT
GGTTGTATGATCGATAAAATTTATTATGTATCTGTTGCTGTTTCTATCGCGAAGCGAGATCGGTCCTTTGATATCACTGCAAATGACTGCTTCAATTCTG
TCCGTAGGCGCACTTTGACCGGAGTCAACTTTCGGCTGATTTGCGCGGGTATGTTTTCCCTCCGCGTAAGTTAAGCAGTTTGTACGAACTTGACTTGTCA
ACACTATTCCTGATTAAGAACCATTCGCCAAAAGTTCAATCTTTTCGTATTCTAATTGCCCAAATCGGTTGTGAAACTCCATTAACGTTCCTCGTTGGTA
TGTACGGTCGTCTACAATGTTGTCGGCAATAGCGGCCATTACCACTTCCACAAAGGCATGTTCTCGCCGATGCTGCACTCGGTCGATCATTAAAACATCG
CTAACCATCTTCATGTAGAGAACTGTGCGTCCATCTTTCGCTATTGC