Description :
From Genome Similarity Track
Location :
Scaffold_5:183515- 186755
Sequence
3240 bases(100 bases per row)
GAGACGTTGAACGTCTTGGCGTGTACCTGTGCCTGGTTCCGGTACAGGGAATGGCTCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAG
GTATGAGCAGGAAGCGCTTCGCGCGTGACTTGCATGATGGACGCATTGAGCAGATCTGCATTCTCTCGGATGCCGAGAGGACGAAGAGCGAGAGTGAGGA
ACTGAGGCAGTTCTTCATGGAAACACCACTGAGAGCGAGGCCATCCTCAGTGCGAAGACGAACTAGGGGTGCTTTGAAGAGCAGAGCTGGGACTCGCTGA
AGTCGAGTCCCTTCTACAAGATTCTACTGGAGCTCGAGGACGTGCTTCCGGAAGAGATCCGCGCGGAGCTTCCGCAGGACAAGGGCATTCAGCACGGGAT
TGATCTCGTGCCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAAGTCAAGGCTATCGACGCCTTCTTTGAGAGTCGTTAAAAA
GCTGGACAAGTGCGGGAATCGAAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCG
ACGATACCGGCGCAGACCCCGATACCGCGAAAAGATGCTATCATCGATTCGATGGTCAAGAGCACTATATACAGTGCTTTTGATCTGCTTGATGGGTTCT
ATCAGATCTTCATTCGTGAGAGCGATATCCCGCTCACGGCTTGTGAGCACGCCAAGCGACATGTTCTGGAAGTGGCTAGTGATGCCACAGGGTCTGAAGA
AAGCCGCTGCAACCTTCAACAGGTGCGTGAGGTACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGAAGTGTTCGTCCACAGCCGTGC
TGCGGACGGGATGAGCGACGTCGGGATACACAAGGTGCATCTCCGAAAGCTGCTTGCGTAAGCATAAGCTCTACGCAAACCTGAAGAAGTGTATCTTCGG
GGCGAGCGAGATATTCGTGCTCGGGGATCTCGTTGGGAAGAATGGTGTCCGCCCTGACCCTGATCAATGATTGGCCGACGCCGTCGAACGTCAAGGAACT
GCAGCAGTTCCTTGGCTTGGCCACGTACTTATGTAAGTACGTGAAGGACTATGTGGGCACGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAG
TGGGTTTGGACTGCTGAGTGTCAGCAGGCATTCGATGCAGTCAAGCAGGGCTTGACTGATGCGCTAATCTCGGCAGTGGCGGACCAAGATCGTCCATTCG
ACGTTGTATCTGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCGCGAGAGCCGTGATCGTGTCGTCTACTACCAATCGCGCCAGCT
GAAGCGGGCTGAGCGCAACTACCGGTGCATGACAAGGAACGCCTGGCCATGAAGTATGCACTCGCGAAGTTCCGAGTGTACTTACTCGGAAGCAAACCGT
TCGCTGTCTATACGGACCTCGCGTCGCTGCGGACTGCTGTGAAGTCTCCGCACATCTCGCAACGGATGGCGAGATAGCTCTCGTTCTTCGCGGAGTATAA
CTTCCGGGTTAAGTACAAACCCGAAAGGCTCAATGTAGTGGCCGACGCGATATCGCGTCGACCCGACTATGCTACGAATGATGCCGACGTCAATGCCATT
GGTGCCATGCGATCGAGTTCCCACGTCATCGTTGATGGACAACGTGAAGGCCGCGTACGCGCGCGACGCGGACACGAATCTCTTGCTGGCCTACGGCTCT
TCGCCTTCTGACCAAGCTCGTCAGAAGCTGCCGAAACACCTTCGTGCTAGTGCACACCGCTATCGGGTGCACGATGTGTTACTACTCTACAGTGCAGTCG
CCGGCAACGCGGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGAACATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCG
TGAGAAGACATACCTTCTTCTTACGCGAGGCTTCTACTGGACCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTG
AAGCCTGCGCCCTTCGCGCAGGCTCCCTTGCAGTCACTTCTAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGATTTCGTGTTCGGTCTTCCCCCGG
ACAGCCAGGGGGTACGGGCGTTGTAGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCG
CGTCTGTTCGTTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGGGT
TTACACTTCTGGGGAGTCAACTTTCGATGTCGACTGCAGACCATCCGCAGACGGACGGGCAGACCAAGCGCGTGAACTGCGTGCTCGTAGACGTGCTTAA
GAGCTACGCTCACTCGTTCCAACACTGGAGCGAGTGCCTGCCGACGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCCTTC
TACGTGAATGCCATGAGGCACTCAAGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTGAGTGGGGGAGGAGCTCCGACTGCACCGCAGCAACCGC
AAAATGCCGCTGACACTTGCATAGTGTCAGCCGCGACCACGCTCAAGAAGAAGAACGCGTCTGTGTAGGGCACAGACGCCGACAAGCGCACGAAGAACGT
GTCTGTGCGGGGCACAGACACCAACAAGAAGAAGAAGAGCGTGTCTGTGCAGGGCACAGATACCACGAAGACCAACGCAGAGGCAGGGCCTACTGCTGGA
AGCGAGAAGAACGAGTTCAGCTAGGACACAATTACATTCGTGCAGCGAAGACAAGCCGTCATTCGGTTTGTCCAAGACACTATTGAAGCTTCTGGCGACC
GGCAGAAGCTGAATGCAGACAATGTTGGCAGGGGCAACACTAATGAATTCGAGAAGGGTTCATTAGTCTTGTTAGCTACTTAAAACTTACCTAAACATGT
AGTGTCCGGCTTAGGAGCAAGCAAGCTTGCTCCGCGCTTCATCGGTCCGTACGGCAACGCCTACACTATGAACATACCGTCTAGTATGCGCCTTCATCCG
ACGTTCTACGTCGGACGGCTGAAGCCATACCTGCAGCATG