Description :
From Genome Similarity Track
Location :
contig_35:183462- 188554
Transcript NameFunction/comments
g7967.t1hypothetical protein
g7968.t1hypothetical protein

Sequence
5092 bases(100 bases per row)
TCACCAGACGTAGGTGACTCGTGCTGCACGTACGGCTTCAGTCGCCCAACGTAAAACGTTGGGTGCAAGCGCATGCTGGACGGTATGTCCAGTGTGTACG
CGTTGCCATGCTTCGCCAACACGGTGAATGGCCCAATGAAGCGCGGAGCAAGCTTGCTTGCTCCGAAATCGGAAACTGCATGTTTAGCTAGGTTCTGAGT
AGCTAACAGAACTAATGAACCAACTTTGAATTCATTTGTGTTTCCCCTGCCGATGTTATCGGCATTCAGCTTCTGTCGATCGACAGAAGCTGCTATTGCA
TCTTGGACAAACCGAATTACGGCTTGTCGACGCTGGACAAAGTCCATTGCATCCGAGCTGAACCCCTGGTTCAGTTCGTGCTCCTTGTTCGCAGCAGGCC
CGGCCTGCGCGTGATGTTCGTTGTGTTTAAAGTGTCTACGCCCGTCGTAGACACTGTCGTTGTCGTCGCCATGACTGCGCGCAGTACGTGCGCGAGTCGT
CACAGCTGATACATTGCTTGTATCAGCGTGCTTATCCGGTTGTTTTGAATTAACCGGATATCCTCCCCCACTTAAGGAAGGAGCTACCGCACCGAGTACG
CTCGGTACGCGTGGGTGCCTCATGGCATTCACGTAGAACGGTGTGTGTCCTGTCGAGACATGCACCGAGTTGTTGATGGCGAACTCCGCCATCGGCAAGC
AGTCGCTCCATTGATGGAACGAGTGCGCGTAGCTCTTCATGGTGTCAACCAGCACGCGGTTGACACGCTCTGTTTGTCCGTCGGTCTGCGGGTGATCCGC
AGTCGACATGGACAACTGCGTCCCAAGAAGTGTAAACACTTCTTGCCAGAATCGCGCTGTAAAGCGCGGATCCCGATCCGACACGATGTCGAGTGGCATA
CCATGGTGTCTAAACACCATGTCGACAAACAGACATGCCGTCTGTTTGGCTGTCACCTCGGCTGGTACTGCAGCAAGATGCACCATCTTGCTGAAGCGGT
CAACAAAGACCACAATACCAGTCCTCCGCTTGTTGTCTTGCGGAAGACCAAAAACAAAGTCCATTGAAATGGACTGCCAGCACTCCGACGGAGTCGGTAG
TGATTGAAGCGGAGCCTGCGAGTTGGGCGCAGGCTTCACGCGCTGGCATACCTCGCAAGCACGAACGTACTTGCGTACCCACTTGTACTGGTGACTCCAA
TAGAAGTCACGCGTGAGAAGCAAATATGTCTTCTCACGGCCAGGATGTCCCGATGTCGGGGCATCGTGGTACTCGTACGTGATCTTGAGCTTCAGCTCAT
GATCATCCGGCACGACAATGCGATCTGCGTTGTCGTCGACTGCGCTGTAAAGCAGCAGACCATTGTGTACACGATAACGGTGTACACGGGCACGAAGGTG
TTTGGCCAGCTTCTGACGAGACTTGTCAGAAGGTGTGGAGAAGTACTCCACAATTGCTTCGCATCCGCATCATGTGCGTATGCGGCCTTCACTTCGTCCA
GCAAGGACGACGAGGGTGTAGTCGTCCTGACGACGCCAACTGCGTTGGCGTCGGCCTCTTGCACCGCATAATCTGGTCGACGCGAAAGCGCGTCGGCCAC
GACATTCAACCTTCCAGGTTTGTACTCAACCTGGAAGTTGTATTCAGCAAAGAATGACAGCCACCGTGCCATTCTTTGTGATATGTGCGGCGACTTGATC
GCCGTACGCAACGATGCGTGGTCGGTGTAGACCACGAATGGTCTACTCCCAAGTAGATACACTCGAAACTTTGCGAGTGCATACTTCATGGCAAGGAGTT
CCTTGTCATGTACCGGGTAATTGCGCTCAGCTGGCTTCAGCTGACGCGATTGGTAGTAAACCACACGATCACGACCTTCGTGATCGAGTTGCATCAGTGC
GCATCCGATCGCGAAATCGGATGCATCGCACACAACGTGGAATGGGCGATCTTGGTCGGCCACCGCCAAGATCGGCGCCTCAGTCAAGCCCTGCTTGACT
GCTTCGAAGGCCTGCTGACAATCAGCAGTCCATTCCCATGCAGCCTCTTTCTTTAAGAGCTGCGACAGCGGGCGAATCTTGCCCGCGTAGTTGCTCACGT
ACTTGCACAAGTACGTGGCGAGTCCAAGGAACTGCCGCAGTTCCTTTACGTTTGAAGGCGTAGGCCATTCATTGATCACTCTGACCTTTCCTGGGTCAGG
GCGTACGCCGTTCTTCCCCACGAGACACCCAAGTACGGGTATCTCGGTCGCCCCGAAGATACACTTCTTCAGGTTCGCGTAGAGCTTGTGCTTTCGCATG
AGCTCAAGCAACTTGCGGAGATGCTCTGTATGCATCTCCACATCCGATTTCCCATTCACAGCCCGGCTGTGAATGAACACGTCGTCGAAATAGCTCGGTG
CGAAGTCGCGCACCGAGCGCAACAAGTGCGTGACGCACCTGTTGAACGTCGCTGGGGCGTTCTTCAGCCCCTGCGGCATCACGAGCCACTCCCAGAGCAT
GCCGCTCGGAGTGCTTACCGCTGTGAGAGGGATATCACTCTCACGCATGAGGATCTGATAGAACCCGTCTCTCAGATCCAGAGTACTGAAGATAGTACTC
GAGGTCATCGAATCGATGATCACATCTTTTCGAGGTATCGGCGTCTGTGCCGGTACCGTCGCATCGTTCAGCTTGTTGTACGCATGAACGATGCGCCACC
CGCCCTGTGGTTTCTTCACACAGAACGTAGGCGCGCTGTGCGGGGACTTCGATTCCCGCACTTGTCCTGCATTGCGACGACTTTCAAAGAAGTCGTCGAT
TGCCTTGACTTGCTCACGCGGCAGTGGCCACTGTCGCGTGACGCAGTACTTCGTTCCCGGCACGAGATCAATCTCGTGCTGAACACCCTTGTCCTGCGGT
AACTCCGCAGGAATGTCGTCCGGGAGTACATCCTTGTACTCACGCAAGACCTTGTAAAAGGGGCTCGCCTTGAGCGAGTCCCAGCCTTGCTCGTCGAAGC
GTTCCTTCTTCGACTTCGCGCTGAGGGCGTCCGCGCCCTCAGAGATGAGCTGATTCAGCTCTTCTGCTTCACACGTCATCCTCTCGACGTCCGAGAGGAT
GCAGATCTGCTCGATGCGTCCATCGTGCAGTTCGCGAGCGAAACGCTTCCAGCTTGTGACTGGGAGCGACATCAACTCCGACGCTAACGTCGGAGGATTA
TTCAGCCTCATCTTCTTGTATTGGAGACCAATACTCGACGCGTCAATGTCTCGACGGTCGTCTCCAACTCCTGTGTCTGCCCGGCAGACACTGCTTGTAG
CGTCTCGGTCCCTGACCGAGACTTGCGCAGCTTTTCTCGCTTGCGCCGTTCACTTCTCGTGCGGAGCCCGGCTCCGCGAGTTTCTTCTTGTCCAGGCCCG
GCCGTGGACAGTTGTTCCTTGTATTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCACCGCTTCGTCGTGCAGCCCGG
CTGCACGCGAGCTCGCAAGCATTTCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGCAGCGTCGGCTCCCAGAGCCGACGCGTCTTCTTTACCTCT
ACGCCTAACGGCGGAGTGTCTTTCGACCAATTGTGTGTCGACATTACCTGTCGACACTACCGCGTCGCCCCGGACGCTTCGAGACCCTCTCGAATCGGAT
TGAACCAGGCCCTGCTGATTCGGTTCACATCTTCTAACGACTCTCGCAGTCGTTGGCGTTCGCTTGGGGTGACCGGAGACAGCCGCATTCCGCGCTGTCT
CTGTGGAGGGCCGCATGCACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCCGAAGCGCACGATCGTGCGC
TTCGTCCAGTCGATCACCGGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCGACGA
ACTCCTTCTCTTGATAGAGAAGCGTACGCGTACGATACGCTTCTCGGTTCTAACAACGACACCCGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTT
TCCACCTCCTCGAAGTCAAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGACGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCTCTCTTCG
AGCTTACCTTCAGGATGACAAGGTTCGGCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTCTCACTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGAT
GTCGACACGCTCGATCGCATCACCAGCAGGGCGCCCCGCGCCTGCTGGTCCCTTTAGTTTTTTGATTGCCCGTGCGATACCCAGTATCGCCACGACGGCT
CCTCGCCGCGTGCACAGGTGCTGTGCACTCGCGGGCATAGTGACCGATGTTTCCGCAGCGGAAACAACGCACATTCGTTGATCCACGACGCTGCTGGGAA
CCAGCAGCTCGCACTCGAGAGGTCCATTGGTTCGGGACCTCCCGACGGCCTTGCCACCGGTCGTGGCATCAGCCGTGGGGCGTTCACATGCAGTTTAGCC
TGCCGCAGGCTAAACTCTTCTTGCATTGCAAGCGCAATTGCAGCCTCGAGAGTATTTGGATACTCTCGGAAGAGATAGGTCTTCACAGGCCCATCTCTAA
GGCCCTTCATGAACGTGACGACCTTTGTCGCCTCGTCAATCGGGTTGGTCACGATGTTCGAGACCAAGTACCGTGCTCTTTGGGCGTAAGCATGCACGTC
ATGCTTGCCCTGTTGCAGATCGAGGAACTCCGCCCTCGATCGGAACTCGTTTGCGGGGGCTCAAACGCTAGTTTGAGCTCCTCCTTGAACTCTTCGTACG
TGCTAAAGCACGTAGGATCTGTGAGTCGGCGTCCGTACGCCCAACTCCTCGCTCGTCCGCCAAGACATGACATGGCGAACGCAACCTTCGACAACGGGTC
GACGATACGTCGAGCCGTAATGGCAGTGTCGACCTCGACAAGCCAACGGAGGAGAGGTTCGCCCTCTCTTCCAACGTAACTGCTTACGTGGA