Description :
From Genome Similarity Track
Location :
scaffold_476:18345- 21088
Transcript NameFunction/comments
Pl_104537hypothetical protein PHYSODRAFT_478276

Sequence
2743 bases(100 bases per row)
GGCAGCCGCAGCTGGGAGCTTCCGCAAAGTTCATCTCAATAACGACGAGGAGAATGAGCGACTGCGACGTGAAGGGAGATATGCCGACAACTACGTGAAT
ACGTCCAAGTATACAATCGTGAGCTTCATTCCGAAAATGCTCTTCGAGTTTTTCCGAGTTATCGCCAACTGCTACTTTTTGGTGATATCAATTCTTCAAG
TGGCTACGACGTGGTCACCGACGAATAAATACACTACGGCAGGGCCGTTAGTTACAGTGTTGATGGTCTCTATGATCAAGCAGGGAATCGAAGATAAAAA
GCGTCATGATGCTGACAATGTCCAGAACTCAAGACAATGTAAAGTCCTGGGACGTCAAAGAGAAATTGTGACGAAAGAATGGCAGGAAGTGGCTGTAGGG
GATATCGTGCGCCTTGGCGACCGAGATGAAGCACCTGCTGATGTATTTATTCTATCGACGTCCGAGGAAGAAGGTCGATGTTTTGTTGAAACCTGTAATC
TGGACGGCGAAACTAATCTAAAGCGACGAAATGCCATTGAACAAGTGGCACAGCATGTTGGTTACAGAAAGTTGAACGATCCAATATTACCAGAAGCAGA
TCACAGCAAGCAGATGATGAAGCTCAGTGCCACAATGGAATATGAACAGCCTAACAACCGACTGTACAACTTCACAGGTAGAATCGAGTTTGGTCCCAAC
AAGGAAGCTGCGCCAATAGGTCCGTCCAATATCGTTCTACGCGGCTGCAGTGTTCGCGGTTGTGCATACATCTACGGGGTCGTCATTTTCACAGGTTCCG
AAACCAAACTCATGCAAAACGCACGCTCGACGCCGTCAAAACAAAGCAATGTCTACAAGGTTGTCAATCGCTGCATTGTGCTGATCTTCACCACGCAATT
CGTATTGTGTATCATCAGCACCATTTGCAATACGATCTGGATGAACAAGTACCAGGAGAATCTCTGGTATTTTAGCTCAGCATTTACGCAAACGTCATCT
GGCTCCAACTTGGTTAGCTTTTTCACCTTCCTCATTCTTTACAACAACTTGGTTCCAATTTCTCTGTACGTCTCGCTAGATATGGTGAAAGTTATGCAGG
CAAAGAATATTGCCACTGATCCAGAAATGTGTCACGAGGGAACGTATGCAAATGCACGAACGTCCGATTTGAATGAAGAGCTGGGTCAAGTACATCACAT
ATTCAGCGACAAAACGGGAACTCTCACGTGCAATATCATGGAGTTCCGGAAGTGTTTCATTGCTGGTGTATCGTACGGATTCGGTACTACCGAAATTGGT
CGTGCAGTGGCAGAACTGGCAAAGAAAAATGCTATTGCCAATGGAACATCGAGTGGTTCTACCGATTCACGTGGTAACGAAGACGATGGCAAGTATCACG
ACCCACGAGATGCCCAAGTGGACTTCAATCCACTTATCCACTTTGATGACCCGCGTTTAGTCAATGCGCTAGCCTCAAATGCTCCAGAGGCTACTGCCCT
TGACGAGTTTCTCACCGTGCTCTCTGTGTGTCATACAGTGATCCCTGAAACGAACGCGAAAACAGGTCAAGTTGACTATCGTGCTTCTTCTCCTGACGAA
GAAGCACTTGTAAAAGCTGCGAAATGTTTGGGGTATAACTTTACTACACCAGCCCCGCTCTTGGAAGTCAAAGTGACCAAGAAGAATGGTTCATCAACTG
TGCGCAAATACACGATTCTCAATGTAAACGAGTTCAATAGCACGAGGAAGCGAATGTCGGTGACACTTCGAACTGAGGACGGTCGCTACTTTCTCTACTG
CAAAGGAGCTGACAATGTCATGATGCCTCGCAGCAAGGTCGACAAATACACCGCCAAAATGAACGAGGAGTTAAAGCGGTTTGCAAGTGAAGGTCTTCGA
ACGCTGGTGATCTGCAGTAAAGAGCTGACAGAGGAGGAGTATCTGGCTTGGGATGTTAAGTACCAGGAAGCTGTTACATCTTTGACGAATCGTGATGAAC
TTTTGGAGGAAGTTGCTGAGATTATCGAGACCGAGATGAAAATCGTAGGCGCAACAGCAATTGAAGACAAACTCCAGAATGGCGTACCGGCTGCAATCGC
GAATCTCGCTCAAGCAGGGATAAAGATCTGGATGCTCACGGGTGACAAGGAGGAGACTGCAATTAATATCGGACATGCCTGTCAATTGATTAATGAAGGA
ATGCAGTTGCTTACCGTTAACTGCGAGGATCTGGACGACTTGGGCAGGCAAGTTGACAAGATTTACAAGATGGAAGATGTGCAGTCACACATCAATAACA
ACAAAGTTTCCAGCCACTTCGCACTTGTGTGCGATGGTAAAGCGATGGTGCACGTGTTTCCACCAAAAAATGCGTCTTCCGATCGAACAATGCATGCAGC
AAAAGTCCTTTCACAAATGATTTTGGACATATCCAGCGTTTGCCAAGCTGTCATCGCATGCCGTGTAAGTCCTGCTCAAAAAGCAGACATTGTAAATCTC
ATTCGATATAACTCGCCACAAAAACCAATTACTCTAGCGATCGGTGACGGAGCGAACGATGTGAATATGATTCAATCAGCACACGTAGGTATTGGAGTAT
CCGGTCAAGAAGGTGTTCAGGCTGTCAACGCAAGTGACTACGCAATTGCTCAATTCCGGTTTCTCGAGCGGCTTCTTCTTGTTCATGGTCGCTATAACTA
CCAGCGGATATCCAAAGTCATTCTCTATTCGTTCTACAAGAAC