Description :
From Genome Similarity Track
Location :
Scaffold_95:183403- 187636
Transcript NameFunction/comments
g13497.t1hypothetical protein
g13498.t1hypothetical protein

Sequence
4233 bases(100 bases per row)
ACAACGTCGAGGCGCTGCTGGCCAGACACAACAAGAAGTTCAAGGCCATGCACACGTACGAGCCCCCGCGGCACTCGGTCCGGGAAGTGAAGCAGGTGAG
ATATGAGTTTTTAGTACTTGTTGGAGACTTTTTACTGACATTATTTTTTAGTGGGAACGCGAGATGAAAAGGTCTTATTATGCTTTGTCAGCCGAGGAGA
GGGTGCAGGCAAACCAGGAGATTGCAGTCTGGAAGAAGCGACGAGTGGGGACGACCCACTAGAGAAGTTGGAGACGACAATTGTAAAGTTAGTTGATTTT
TATCTCGTCTCACATTGTTGTTGACTAGGTGTCTAGCATACAGAGCATTGCACAGCCACGGCGGATCCAGTGGTCGGGGCTTTTGTCTGTGGGAACGTCA
AGAGCGACGACAAAGTTGGTGGAGTGGCCTGTGGTGGAGAGTGTGCCGGCGCGGATGGAGGTCTTGTACAGCGGGCACTCGTACACGTCCGACGGCTTGT
ACTCTTCTCGTCGCATGGGCTTGAGCCAGATAACAGGCATGCGATCGAAGAGCTCGTTCGGGATGGACTCGGCCATCATTCGCGTGTTGCGGTCATAGCG
CGCACCTTCCATGAAGAGCCCGAAGATGTACACGCCGAAAGGCGGCGCAGCTTTGTACTTCTCTTTGTCCTGTGCCATGATCTCGCACGAGACAACGAGC
GCGTCAATGGCGATTTTCTTGTCTCGAGAGAATGACTGCTTGACGGCTGTCATGAAGCCCTGTGGAAAGAAAAAGCCTGACAGCCAGAAACTCAACGGCG
GCCCTTGCACGAGCCAGTCGTTGGTCAACGTGATTCGTATGACGAAGTCTTCTATCCAAGAGGCCAACGGCTTCAGGCACGGATATCCAGCATTCTCCCA
CTCGCTTGGAATTTGCTGGATCAAAAACCCATTGTACATTTTCTCGAGCGGACCAGACATGACCACCAGCCCCTTGATCGCACGCTTGAGCATCTCAAGT
GTCGTCTTCATGACTTGAATCAGCACATTGAAGCGGATCATCTCCTGCGACAGGAACACGCCCAGTGAGTTACGACTACCGCCTGCTGCTTCTTGGAAGG
TCGATGGGTGCGCCTTGCTCTCCATGAACGCATCGGGCATGCGTTCTTGGATCGCTAGCACCATCTCCATAACAATGCTGTCATTACTCTGCGCGGCACT
GCCGCCGCCGCTATCGCCACCTCCACCCAGCATCTTCAATATCGTGCCCAGCAGCTGACCAGTTTCCTTTTGCTGGAATGTGATGTCTGCGTTGGCGTGA
AGACCGAAGATGTCAGGGGCATCTGCTGTCGGCAGTGAGCTCACGTACTCGCGGACAGTAACCAGAGAGCCTTCGACTGGCGCATAGTAGAGTCCCGAGG
TGGTGAACTTGTACGAGTCGTCCATGACTCCTTTGCAGAAGAGCTTGCGCATGATACTCGAGTTCGTTCGCTTGTCCCAGCGGTCCGTTATGCGACCACC
GTAGGAAATGTCCGCTACCATGACGTTCAGCGTCAGGTACGGCACCTCTTCCTGTTCCTCCAGATACAGCCGTACCTGCTGCATTCCTGTCTTTAAGTCG
CTGTTCATCCACTCGTACGGGATGTTCCAGCCAACAGCACCAAACTTGCGTCGCTCAAGACACACAGCGTTGTAGAAGGCTAGCGCGAATAGCAGCTTCT
TGAACTCACGCGGCTTCGTGCAGCCTTCGAAATCGGCCTCTTTCATGTCAAGGAACGTACGTCCTAGGTTTGCCTTGATACCCTTCGGAGGCTCATTCGT
GATCTTGATTCCATTCTGCAGGATAGGCACGGGGAACCGAGAACTTGGCATACTGGTGAGCCACAGCCTAAACTCCTCGTGCATCTCCTCCGTCGCTGAT
TGCTCCAAGATCTGCTCAAGCCGTCCTAGCCATGATACAGCCAAATGACAGTTTTGCAGACACACCCAATCACCCGTCTGTTTAGCTTGTTTCATGAGAG
CTTCAGCAATCGGGCCTTGGCCTTGCCCAAGCGAGATAATCTTCAGACCAGCTCCATCTTTGCCTTCTTGTTTGGCGAGCTCCAAAAGGTAGTCGTTGAT
ATCGGCGCCCGGTGAAAGTACGAAGATCAGCGGTGTCTCCGGCTTTGAGTCTCGATAACAGCCTCCAAGATCGAACGGTGGAGACTCGGTGAAGAATTTG
CCCAGCTCACGTCCGACGAACTCGCGCGTTCCAAAGACGAGCATTTCCTCTCGGAAGACGCGCAAGATTAGCAGCTTTTGGAAGTTCGTAAGCGTCGATT
CCCAGGGTTCCGGTAGTGCTTCGGCATGCGGTAAGTCGGCCAGAACCATTGCACGTTTCCACTCCGTTGCGTGCTGTCCAACGGACGAGGCCAGGTCAGT
AAATGCCGGAGAAGTATCCTTCATACCAACGACAGTCTTCCACACCCTGTCAGACAGCCAAGACGGACGCGTAAGACCACACGATTCAGCCTGTGCGGCT
TGAACGGCTGAACTTCTCTTATCGCCCACCAGGTAAAAGTTCCATTCGCTGGAAGAGATCGCCCCGCGATGTAAAAGAATACTTGATGCGATCATAAACG
CGTAAATAATCTTGTCTTTCTCGAACAGCCCGCGACAAACGTTTACAAACATGGATACGGTGATATCCTGCATGAGAATCTCCAAACGTTCTTCCAGCAC
TTCGGACTTGGTCGAGTTTTGAAGCCGCATCACGAATAGCTTCTGGTAGAACTGCAGCGAATACTGGTACATGGGGTCCACAAGCGCAAGATTCGCGATT
GCGAAGTAGATAATCGATCCACGTACAGCAACACAGCGGTACCCTTCACGAGTTTGGTCGATCTCCAAGGATGTCGTCTCTGCCTCAGCCATACGAGTCT
TAATCGCAGAAGATGTTACCTTACTGTGAGCTAGTGTGTCGATGAGCTCTTCATCATCCAAAATGTTACCCTTGGAGTTCTCAAGCATGTACAGAATCTT
GTCTTCGATCTCCTTGAGCTGCTTTTTATCGGCTGCAATGTTCACTGTAAGCTCATTCTTCTTCTGCTCTAGGTCAGGACGCTCACTTCGCACAACGTCC
ACCAACAACTGGTCCTCGAGTCCTGTCAGCGTGACCGTAAAGTTGATAATTGTAACCTTAATGCAGATCTCAGGCATGTAATGCGGGTTTGCAAGCTTTG
TGGTGATGTAGAACCGAAAGTTGTCGCTGTATGGGACATCACTGTCACCAAGATGCAGAAGGTTCTGGCCGCCACGCTTGAACACTTGCTTCAATAGCAC
GGGCTCCAATGAAGGATCCAGGTCCTCTTCCACATTCTCCAGCATCACGGGCGAGCCGTACCGGATCGCATTTTCCAACGTACGCAGGAAGTCCTTTTGC
GATAGCTTAATGATCTGGAGTGAGTTTGATGCTTTATACATGTTCTTGATCCATTTGTTGGCTTGTCCTTGGGGATCGATCATAAGCGGCCAGCGGCGCC
CCATGGTTGTGAATAACCCATTCTCAATCGAGAAGGTGTCAGCCGGCAAGCCCATGATATTCCACTCACGTACTACAACGGGGTCGGCTAGCACGCGCTG
GAAGGAGAAATGACTATCAACCGGTAAATTGCTAGCCTTGCAGAACGAGACCCATTTCGCTTGAAGCTCGTGACGGTATTCCGATGTAAATGGGCCAAGG
TACGCGATGCAGCCTGCGGACAGGATCATGTCGCCGACTAGATTGATCATATCCTTTCCCAGGTTTTCAGCGCACTCTTTCCAACGGCCTTGCTCCTCGC
CCAGCGAGTCGATCAACCGCTCAGCGCGTATGAGCTGTGCCTGCGTCTTCTCCGACTGCTTCTCCAAATCTACTTTCTTCTTTTGGGCATCCTCAAGTGT
TCGTTTCAGGTCAGCTACTTTCTTGAGCACCGCATTCAATCCGCTTTGCTTGACATCAAGCTGTTTTTGCTCCTCTTCGAGTCGCTGCTCGGCTGCCTTA
AGGTTCTCCTTCTTTGGAGCAATGTTCTTGGCAACGGTATCATACGTATACATGGCTCGCACCCACATACAAAGCGATGTTGCAGCGGTGGAGATACTGC
TCAGCGTTTCAGGTGTAAACTCTTCGTCAGTCATAAACTTCTGAAGCTGGCGAATCGTCTTCGGCGGAATATTGTCCTTGTCGAACTCTTTGAGTTTGTC
CAGAAACTTCATATCGTTAAGCAGCTTTTTGGC