Description :
From Genome Similarity Track
Location :
Scaffold_15:183387- 184630
Transcript NameFunction/comments
Sappa_CBS223.65SPRG_05195Hypothetical protein

Sequence
1243 bases(100 bases per row)
GCTCGGCCATCAACGCCACGCAGGCTCGAGAGCTGCGTGCACTGGAGGCAGCGCATGCCAAGGACATCGATGCCATGGCCGTCCGGCACCGCGAGATGGA
AGCCCAGCTCGCAGCTGCGGCCAAGCACGCTGCTGTGGTCCACGAAGACGCACTGGCCAAGTGGCGGCACACGACCGAGCGTCAAGTCGACGAGATCAAC
GATCTCCGAAATCAGCTCGAAACGATGCGAAGAGAGCTCGTGGCGCTGCAAGTATCGACGTCCGAGAGCCACGTGCGGGCCCACGTGCACCACGAAGTCG
AGGGCGTCTACTTGGCCAAAGTCGCCTCGCTGGAAGCCGCCCTCGCCCAAGCCGGCGCCGCGTGCCAGGCTGCGCACGACCAAGGCGACCTCGCGCTCGC
CCACGAGAAGGAGCTCCATGCCCACGCTTTAGCGACTGCGAAAGCGATTTCGGACGAGCTCGAGACCGCCAACTTGTGCTTGGCCGAGCGGAAGCGGCAG
CGCGATGCGGACCAGCGCGCGTTTGAAGAGCGGGAGGCGCGCGCGGCGCGATCCATTGCGCAATTGACGCAGGAAGTTACGCTGCTGCGCAGCCACGTGA
ACGACAAGGCGCACGTTGTGTGGAAGCAGCGGGTCGCCGAGGCCGAGGCGGCGGCCGCGCAGTGGCAAACCAAGCACGAGGAGACGCTCAAAGCTCTGCA
CATGGCGCAGGCGAGCGCCGATATCGGCGGCTTCCACCGGCGCGAGATGGAAGCGGCTATGCGCGAGCGCGACGAGGCGCTCGACCACCTCGTGCGCGTC
ACCAAAGAGCGTGACGACGTGTCGGCGACGGTCGTGACGTTGCGGAAGCAAATCGACGCGCTGACAGCGACGCTGCACGACGCCCGCACCACGGTCGTCC
AGCTTCGGTCCGAGCTCTCGGGCATGTACGTCCCGACAATGTCCATCAATATGGGGAGATGGATGATGCTGTGGTAGGGAGCACTTGCTGACGCAGGAGA
AGCGAGCCCACGACCAGCAGCAGCGGGACCTCGATGTCGAGACGCAGCGTATCATGGAAGAAAAGCAGCTTGTGAAGCAAGTGGTCACAGCCATGAACGA
GCGCTTGGCCCTCGGTGTGCGCTCGGAAGATGCGACCAAGTGGGCCGGCGTTGTCGACGCGTGCGCTGCCGTCGACTGGCAGCTCCGGCACATGAAGGAC
CGCCTCGAGGAGCTCGCAGGCTGCAAGCCCCGGCGACCGACCA