Description :
From Genome Similarity Track
Location :
Scaffold_144:18336- 25062
Transcript NameFunction/comments
Phypl_g4115conserved hypothetical protein
Phypl_g4116conserved hypothetical protein
Phypl_g4117hypothetical protein PHYSODRAFT_475569

Sequence
6726 bases(100 bases per row)
GTCAGTTTTTGCGGCGGCAACAGCTGgtcaacctgctgctggctcgtTGAGGGAAAAATTGCTAGCGTCGCCAACGCCTGGCCGCGGCAGTCTCGCGTCT
ACCAAGTGTCCATCAGGCGGAATAGGTGCCGCCACAAGTTCCGCGGGCAGGCGACTCTTTCCGTGCTGGTACGACCAGTTTTCGTGGGTGAGCAGCCTCT
GTCGTGCCGATGCCAGCCCCTCCGTCCGATGCCACCATGCCAGTCCCGAGTAACAGTGCACCCGCTGAGCCTGAGGCCAGTCTGGACGTCGTCAAGAACT
GCCGAAGCGTGAGCGACGAGTCGTCGACCAGCGCGTACGACTCAGCCCTTGAGCAGGAGGAAGCACCAGCGAACGACACTAGCGGGGACGAGCAGGGGCG
CGCCTCGGTCGAGACTGTAGAAGCCGAGATCGAGCcggaagaagctggtgaaAAGGAGAGCGAGGTCAACTTGAAGGAacaagcagcgacagctcaggag
gaggaggggggggaggagaagaagagagcTGTCGAGACTGTCGAGCTGAGCGAGGTGAAGCCTGCAGCTACCAAGACGCAGGACGAGCCAGAGCTGGAAA
CGCCCAGTGACGACTCGTGGAACGaagagcagacgcagcaggagaagcagcaggaggaggagaagaagaagcaacCACCGCCGGCACGGCCTGCTACTGC
GAGAAGCGCCGAGTCGAGTTCTGTCACTCGCCGTCCGTTTGTCCCTTTGGCATCGAAGAGCTGGCGCGTGCGAGCCATGCAGTCCAACACGCAGATCACA
CGCCTGATGAAGGCGGCATTACTCcaaacgctgctgcacgctaTTCGCACTGGGTCGGTGGAGGGTGTGAAGGTCGCGATTGAGCGCGGAGTGCAGGTGC
AGTACCTGGACAGCCGCCAGCGCAACCTCGTCATGCTGGTGACCAAGTGCGACACCGACTCTCGTCTTCGCATTGTGATTATTCTGCTAGATGCTGGCTG
TGATATGAACCACAAGGACCAGCTAGGCTGGAGCTGCCTGCACTATGCTTGGTACGTACTACGACGTTGCCTGGTTCTCGCTGCGGTAGACTAACCTTTT
GTGCTTGCACCATGTTTAGCGCCAGCGGAGCGGAtgatgttgctgcagagctcATTCGTCGCGGGGCCAGTGTCGAATTTAACCCCTACGGATACGGTCC
TGAAGACTTCAACATTCCTAAGGTGGCACGTGCAAAAAGTCTGTTGCAACACACggagcaactgcagcacgagcaaaaCGTGTGCGCGTCCTGGACGTAC
TTCCGCCGTCAGGCTGAGAAGTCTGGCTACAGCGTCAAGTGCAAATCGGTATGTACCAGATGGCTTTTATTTTGTATTCACATCAAGCACGGGGCTAACT
GTGCATACGTCTGTTTGCTCTATCTTGTTGGCAGAACTGCGATCTCGGCAAGCCTCTAAAGATCACGTTCCAAGCTCCTGCTGGGCACAGCCCGTTGGAC
CGTGTCCGTGTGGTCGATATGAATTCGGATGTGGCGCTGTGGCTGCAAGTGTCCAAGACCTTTAGTATCCCTCCTGGCGACGTGGGCACGATCACGTTGG
ACGTAGAGACGCTGGACCGCCCGTCGCTGTATCGTATCGTTTACGAGAAATACGAGCCGACGCCTATTCAACTGCCGGCTTCGGTTGCTGAAAGCAGCTT
GTGTGTCAAGAATCTGGACACGGGGACTACCGTGTCTATGGGCAGCATCAACAACTTGGTTCTAaaggagctcaagagctcTCGATCTGCCAAGAAGTCA
AAAAAATTGTCCAGGTCGGCCAGGTAAGCAATTATATTGTTACGTGTTGGTCTGGTTTGTACTAACAAGCGCTGTGATTTTTTTATACAGACCAGCACCG
AAATCGGACAAGGCTACGAGCGTGGTGCGGAGAGGATCCACAACGTACGTCTTCGTGTGAAATGTGGTATATGGTTAAGAGTACTATGCTAAGTTTTGTG
ATGCGGCTATAGTCGAGCTCGGGATATCACGGAAAGCGTGCATGAAGCCACGGTtgaagaggatgaagaaggagaagaggCTGAGTATTCAGCTGATGAG
ACGATTACGACTCAGGAAGTTGCTGAGCACCCGGCGGTCACGAGTATTACTGGTGTGTACAAGATTGTGGCAATGGGAGTTGTCAGTGTTTCGACGCTGA
TAACTGCCAAGGCGAACGAGTATGAAATCACCATTCGGCACAAGGGCCCTCTTGGTCTCCAATTGGTACGCCTTATCAATTTTTCTCGACGTTTATTGCG
GAAACCGCAGGGCGATGGCTAACGTTGCCTTTCCTTTATGCTTATAGGCTCCCAAAATTGAAAGCTTGAAGAGATCTCCGCGTCTTATTGTGCGCCGCAG
TCAGGGCCAAGCGGCAGCTGTGAACCCGGGCGATTGCCTCGTTGCGATCGGCAACGCTAACATCGAGCACGCTGGTCTTAAGCACACGCTGTGGGCTCTC
AACGATGCGAAGCGCCCCCTTGTGCTGCGCTTCCGACGTGGCAATGCTAAGGAGAGAAGGAGTCTGTTCAAGGCTGGTCTGTCCAAGATCACGGGATCTC
GTAGACAATCTGTTATTGCGGTGTAATCTAGCAGCTCTACTACTGTAGTTGCAGTTTTTTATTTTGCCGCGTGGGAATAGACAAATGTTCTGAGGCTTGA
AGTGGTTTCATTTAATGTCAGCGGATAAGCGTACGAAGTGAGCTTGTCGTGCGCATACTTACTCTCCCACATTCAGTCTGACAGCGCGCGATGAGGCTTT
CTGGGCTACAACATTGGATGGCCTTTGTCTACGTGGCAGTACTTGAAGGTCCTGTTTTGACTGGCGCATCGTCGGCATAACGATCCAGGCTTGGTTGACA
CGTCAACAACGTGCAACGGGTGTGCCTGCACAAAAAGATGACAGAAGCAACCTTGATCAGTCGCGTCCCAGCTAGCTCGGTGTACAATGAGTTTCGAACT
CACCCTAAAGTGCTCCACCAGATCATCCGGGTGAACCTGTATGCGCGCTTCTGTTTCGGGGTCGTACACAATTGCAGGGTCTGCCATAATAGGCATACGA
GGAAGCGTTGAGTGCCATGACAGTACTTCGCAATTCCTAAAACCAAGGATGCTCACATTGCTTGCCATCGCCACGCCATATATACCAAGCTTGCGCTTCC
CACCACGCCGGCTCCATCGAACCAGCATTCTGATACTATtcggacagcagcagattgAATacaccaacagcagcattAGTATGAATCCAAAATGAGCATG
AGCATCCTGTACAGTAGTAAGCTACTTACTGCGATCGCTAGCATGGATCCTGGCCGCAACGAGTTTGCCCACGTTTTCACGCGCTCCAAGAAATCTGTAG
GTGCTTTGTTCGCCGCGTACTTCTTCATCAGTAGCCACTCGCCATCTTTTCCGTTGCCGCGCCGCCGAAGCCACGGATTGTGTCCGTGGAACGTCCACGT
GTTCGGCAGCATGATTCGGTGTGGCTCGTTCGGATCCACGTAGACAATGCCGAACGCCCAGTGTGGGAACTCCTCCCTCATCGGCCCTGTCTTGTAGCCT
GTGTAGTAGACGAAGAGTTTGTGCACGCACGTCATCTGGTTGTGCATGAACTGCGACCACGACTCCTTCGCCTTAggcttctcctgcttgagcAGTTTAT
CCAAGGGTGCCTCGGCCAGGAACTCTCCGGTGGCCTGCTTTgccatgagctccacgtcgcccttcAACGCCTTGCTGGTCTGTCATCAGGCCACAGCACA
CGTCAGCAACGCAATGCAAGTGTCCCCCGTCTCTCCTCTCCACGCACCATTCCTAGTCTAGCGAGCGCAAAAGGCGCCAGGAACGCCGCAATATacagct
tgagctcgtagTTGAACTGCTGAATGTTGGTCACTTTTTGGTACTtgcgcgtccagctcttcgccgCGACTGCCACGCCGGCGCTGTCCACtcggcgctt
cttggtggcggctTTCCCGGCCAGGTTCTTCTGGAAGTAGGCGctctccacgcgcagcatGCACGAGCAGATGTCGCGCCCATTGCAGCGCCGCGTGTgg
cgcacgagcttggcgtcgacgAGGGGTGCGGGCGCCTTGGACGGGTTCGCGttggcctcctgctgctgctccgagctcatcgtcttctcggcgtcgcttT
TTTAACAGTGTGGGTTCCAACCAACAGATGAGTCAGCGTCATTTGATTCGCTAAAATTCGCTATAAACTCGCATCGCAGCATTTTCAAGTTTGTGGCGAT
GCTGgggcggaggctgcagcgcgcgggGTCCGTGCGGGCGAGCGAgacgcgtcgctggctggcggtggccgccAAGGCGAAGGCCATCAGCCGCGTGCGA
GGAACAAGGGACCTGCTGGCGGAcgactcgcagcagcatcgtgaggtgctgcacgtacTGCAGCGCACCGTGGCGCGCTATGGATTCCGATCGGTGCGTG
TAAAGCGTCGGATTAATGCGTGGTTCGGCGGGTTGCGATGGTGGACTAATGTTATGTTGTCTACAGATCCAAACGCCGCTGTTGGAGTACACGGACCTGT
TCTCGCGGTCGCTGGGTGATGGCTCCGACATCGTCATGAAGGTGTGCGTGGCGTTGGCTGGATTGTGCTTTCCTAAAGGTGGAACACTAAACGTGAAGTG
TCCACTAAACTGGTCGTTTGCAGGAGATGTACACGTTCAAGGACAACTCGGGCAAGAGCGTGACGCTGAGACCTGAAGGCACTGCTGGTAGACTGGATGG
CTTGGTGCTTGAGTAGTTGTGCGACCGCTGCGAGGATAATAACTTGGATGGATGTGGCGTTATTGCAGGTATCATGCGGGCTCTTATGAGCAGCAATCTG
CTGTTTTCGCTACCGCAAAAGGTCTCGTATTCGGGTAGCATGTTTCGGTGCGTGGATGCTGCGGAGTCATTTTCAGCTCAGTTGACGAGGGAAGTGTCTG
TACAAGCTAACGGTTCTTTTGATGCAGGTACGAGCGTCCTCAGCGCGGGAGGTACCGGGAGTTCCAGCAGTTTGGTAAGCTTGCAATGGAAGTGCTCGTG
TGTCTATGAGCAGATGACCTCATGCAGATTCTGTGTCGTTGTGTCAGGCGTGGAATTCGTGGGCTCCTCAGGTCCATCGGTCGACGCAGAGGTACGACTT
GCCAAACCTTTGGGTGGGCAGTAGCTACAATGATCTAATGGAATCTGGTACCGTCGACATGCTGATGCAGGTTATTGCAATGGCTGCCGATGCTTTGGAC
GCCCTAGGCATTAAAGACAAAGTCGTGCTGGAGTTGAACTCTCTCGGAGATAACGAAAGGTGACTTACAATTCTCCGCAGCGGGGTAAGGATTGACTGTG
AGAACTTACACGGGCTCGTCTATATCGTAATAGCCGTGCAAGATATCGCACCGCACTGGAAGCTTTCTTCTCCAAGTGCAAGGACGACCTATCATCGGAT
AGCATCAACCGGTTCGTGTGGCTTTTTACTCATTTTGATTATGACTTGGGTGTATACTTATGCGCTCATCACTTGGCAGTCTTGAACGAGGAAGTGTCCT
TCGGATCTTGGACTCGAAGAGTGAGATCGACCAGAAAATTATTGTTGGCGCGCCACAGCTTAGCGACTTTCTCTCTGACGATTCCAAAGCGGTAGGAAAG
GATACGTATTGTTTGGTGCTGAACTCAGACTCACGTTGGCTCTTGTGCATTGTTTTCCAGCGCTTTGAAAACGTTCTGAGTGGCTTGGATACATTGGGTA
TCGCACATCGACAAAACCTACGCCTTGTGAGAGGACTGGTATGATTATCTGTGTGCCGCTTCGCCGACCGCAGATAAAGTTGTTGACTTTGATGTTTGTT
GTCGAATTGAACGTCTGGTAGGACTACTATAGCAACACCGTATTCGAGTTTGTTGAAAAGCGAGCATCAGATGCTTCCGACACGGAGGAAACAACTAGTG
GTGGTATTGCGGTACTAGCTGGCGGTTGTTACGATGGGCTGGCAGAGTCGTTGGGGGGACCCGTGACAGCTTGTATAGGTTGGGCAGCTGGAATTGATCG
ACTGAACCTTCTCCGCGAGATGCCGACTGAGACAATGTTCTCCGTTGCGGTACGTTAAATGTGCCTATTTGAAAGAGATCCGACTGTCGTAGCCTAATGC
TTATTATTGCTTCGTTTATATTCAATAGGTCGTCCCCGtgcttgctggcgatgaTTCGAACCGGGTGCTTCACGCAGCTATGGGTGTCGCGCAGGTAAGC
TACGGTGTAATTATGCTTGCTCGTTGGGAGCTTGTTGACGAACAACTGTGTTGGCTAGACGCTTCGTCAGCGTGGTTTGACCGTTCACTTCTGCCACGGA
CGTGGcaacatgaagaagcagatgaAGGTGGTGCTACGTTTGATATCCGACGCATTTGTGAAATTCTTGGCTGATTATATTTTGCATGGTTGCCTTCTGG
TGCAGGCTGCTGAACGCTACGGCAGTACTCATGCTGTGATTCTGGGCGGAGCtgagatcgagcagcaatGCGTAAAGGTTAAGAACCTTGGCAAGCGTGA
GGAGGCTGAGGTGCCGATGGAGGATCTGGGCGGCTTCGAGTTCCTTTGAGGATACGACTCAGGTGATGTCAGAACAGGCTTCCAATGTCACTGTGATCAT
TGGCACATAAAGATTGCAGATGAGAG