Description :
From Genome Similarity Track
Location :
Scaffold_32:18336- 20162
Transcript NameFunction/comments
Phyta_totarag1625hypothetical protein

Sequence
1826 bases(100 bases per row)
AGGCAATTGCTGATAATCAGGTTCTCGTGGTCATTGGAGAAACTGGTTCAGGCAAGACCACCCAGATGACGCAGTACATGGCAGAAATGGGGTTGACTTC
CACTGGTATGATTGGTTGCACGCAGCCGCGTCGTGTGGCCGCTTCATCCGTGGCGAAGCGTGTAGCTGAGGAGTTTGGCTGCGAGCTAGGACAGGAAGTG
GGTTACTCCATGCGATTTGAGGATGTCACGAGCCCGGAGACAGTGATCAAGTACATGACTGAAGGCATGCTTCTACGCGAGTACCTGGCTGATCCTACGT
TATCAAAGTACAGCGCTCTTATGCTTGATGAAGCCCACGAGCGGACGATCAACACAGATGTACTATTCGGACTGCTGAAAGACCTTGTGCGCAAACGGAA
GGACCTGAAAATCATTGTGACCTCGGCGACACTGGATGCAGAAAAGTTTTCGCGGTATTTCTTCGACTGCCCAATCTTCACAATTCCAGGGCGTACGTTT
CCTGTCGAGATTCTGTATACGAAGGAACCAGAGCTGGATTACTTGGACGCTTCGCTTCTCTGCGTCATGCAGATTCATCTATCCGAGCCAGAAGGAGACA
TTTTGCTGTTTTTAACCGGTCAAGAAGAAATCGATACAGCATGTGAAGTGCTGTATCAGCGTATCAAGGCGTTACAAGAGCGTGCACTGGCCCCGGAGCT
CATCATTCTTCCTGTGTATGGTGCGCTGCCTTCAGAAATGCAGTCGCGCATTTTCGAACCAGCGCCCAGGGGCTCCCGCAAGTGTGTGGTGGCCACCAAT
ATTGCAGAGGCATCGCTGACGATTGATGGCATTTACTATGTCGTGGACCCTGGTTTTTGTAAGCAGAATGCCTTCAACTCGAAGATCGGAATGGATTCTC
TTGTGGTTGTGCCGTGCTCACAGGCCTCGGCTCGTCAACGTGcaggacgtgctggacgcaCAGGCCCAGGTAAATGCTACCGACTGTACACGGAGAATGC
TTACAAAAACGAAATGCTGCCGACGACTGTGCCTGAGATTCAGCGTGCGAACCTCGGGTCGGTTGTGCTACAATTAAAGGCAATGGGTATCAACGACCTC
ATGGGTTTCGACTTCATGGACCCACCGCCTCAAGATGCCCTCGTCATGGCGCTGGAGAACTTGTACGCACTGGGTGCTCTGGATGACGAAGGCTTGTTGA
CGCGACTAGGAAAGAAGATGGCCGAGTTCCCAGTGGAGCCAAAGAATGCCAAGGTGCTGCTAACTTCCGTGGTGCTTGGTTGCGCGGAGGAAGTGTTGAC
CATCGTGGCGATGATGTCAGTGGAGTCGGTCTTTTTCCGGCCaaaggagaagcaggcgcaGGCTGACCAGAAGAAGGCTAAGTTTCACCAGCCCGAGGGA
GATCACTTGACTTTGCTGGCTGTGTATGAGGCTTGGGCGAACTCCAAATTCTCGAACCCGTGGTGCTACGAAAACTTCATCCAAGCGCGAGCTATCCGTC
GTGCACAAGACGTGCGCAAGCAGTTGCTATCGATTCTAGATCGGTACAAAATGGACGTCGTTTCCTGTGGCAAGAACTTTAACAAAGTCCGGCGTGCGAT
TGTGGCAGGATACTTCGCTAAcacagcgaagaaggaccCGCAAGAGGGATACCGCACCATGGTTGAGGGTCAGCCCGTGTACATTCACCCGTCGAGTGCG
CTGTTCAACAAGAGTCCCGAGTGGGTGCTCTACCATGAGCTTGTGCTCACAACGAAGGAGTACATGCGCAACATCATGACGATCGAACCCAAGTGGCTTG
TGGAATTGGCCCCAGCCTTCTTCAAG