Description :
From Genome Similarity Track
Location :
Scaffold_104:18331- 20021
Transcript NameFunction/comments
Physo_141820hypothetical protein

Sequence
1690 bases(100 bases per row)
GACTGCCCGAAGGCTGTTGCGATATGGGACGAGAAGCAGCGGCAGCTTCGTAAGTAGTCCTTGGCTTCTTGGTCGGTACCCGGGGCACGGTAGCAGACGT
AGTCGCACCACGCCCACGCTCTTCACGAGCTTTGGCTCTCGCCTCTTGCTTCAGCTCGTCCATCTTCGAGTGGAGCTTGGACTTCAACGTCGCCAAGAAA
GAGTGGCTCTTTCTCAACAAGAGCACGCTCATAGGAACCCCTCGAGGTGTACCCGCCACTAAGGCCACGAGGAGCCGAGAGCTTCTCCAACAGCGCTGGC
GCACCAGTGCCAGGCTCGGGCGGGAAGTAGTCCTGCGGGTACGTGGCATCCCCGCCTGAAGAAGACTCGATGGCAGTCGTGGCAGTCGGCTGCCTGGCAT
ACGCACCCGAGCTAGCAGCGTGGTATTGCTGCTGCTGCTCGTCGAGGTTGTTGGAGAGCTCCTTGGGCTCGTGGACGGCACCCTCCTCGTCCTCAGACTC
CGAGTCGATGAACAGCTTGGAGCTGGAGCCGCGAGGCGACCTGGAAGCTGAACGCTTCTTCGCCTTGGCCTCGGCGGCCTTCACAGCGGCAGCCGCTTTC
GACACTTGGGCACGCTCACGACCTTGTGCCAGCGTCAGATGCTTCGATGCCAGCACTTCCTTGGGCTTGGAGCCCGCGTCGCTCGGCGACTTCTCGGCCA
CGACCCCAGCGTCGGCCATGGTGACTTCGTCATGCGACTGCTTGCTGTCGCCTGAGCCGGACTCGGCGTCCTCCGCCTCCTTCTCTGACGAAGCCTTTGC
GTCGACCGAGGCGTTGGTCGTGTCGCCTGCCGCCAGCTCCGTGCCTTTGGCAGCGTGCGTGCTGCCCTCCGAGACGTTCTCGTCGTCGGGTGAACTCTCA
CCGGAGTACTGGACCATCGTGCAGTCAAAGACGGCGGCTTCCCAGTCGCGAGCCGGGCTTTTATGGCCCCGAGGACTCTCCTCCTTGCCTTGCGCGGCGT
CAGGAGACTTGCTCCGAGCCCCGGCCTGACGACCACTCTCCGGCGTGCTGCTACGAGAGTGCACCACCTCCTCGGCCGCCTTCGTGGCCTCCATCAGCGC
GGACGACTCGTCCTTGGCCTTGGCCGCCCTGGTCTTCGGCCCTACGGCCCGCGGTTTCGGAGGTGCTTTCGCACTGCGCGCACTGCGCTTTGGAGGCATG
TTTCCGGTCGACGTGGAGACCCTGCGGCTTGCTCGGCGATGCGCCAGTTGCTCTGTGAGGCCCGGGAGCCGAGGCGCCAGAGCTCGCGCCGTTGTCGATG
GATTTCGACTTTACGAGTGAAATGTGAGTCGCCGGCATAACCTCGCTCTGATTGGTCGATAAGATCGAATTTAAGTGGGGGAGGATGTAACGGGGTTACA
TGGAATAGTGACCCTGTCACTATTCCGGGATGGCTACATCGGTCACTCCCCTGGATAGTGACACAAGTGGCCTCAGAGCCAACAGATACATTTTGTATGA
CACAAACTATAGGGAACTTAGGATTTGTATGCAGGCCAAATCTGTACCAACCTATAAATACATTCAGTCTTAGATCTACCGCTTTTCAAGTCAAGTCGTC
CCCTTCAGACCAGGGACACGTGAACGGCTGTTCACTTGGGTTTGTATACTCCTGCTTCCTCTGATAAGAAGTGCTGTGTGCCCCGTCACA