Description :
From Genome Similarity Track
Location :
scaffold_81:18330- 22406
Transcript NameFunction/comments
g2992.t1 hypothetical protein PHYSODRAFT_324006
g2993.t1 hypothetical protein PHYSODRAFT_383555

Sequence
4076 bases(100 bases per row)
TCTGGCCCAGAGTACCCAGATAAACCAGAGTCTGGGTTCATGCGAACCAGGTAAACTCATATTGTGCATGTAAGTTCCGGAATGCGAAGAACAAAGAGGT
GTTGAAGCCGGCGCCAACTTTCAGAATTACAGGATTTTACAACCGTGCTGCACACGAACTCAGCTATTTCTCGTTTCGGAGATGTCCCTCTTTTATTCCA
TTCCGCAAAAATATCGTTTTCACGCAAGAAGGCAAAGCAAACACCGAACACTTGGGAATGGCGGCTGCGTTCTTGATGATGCTCTTCATTCCTCTTTGTA
TGACCATTGAGTTGGCAGCATTGAGTACATGCAGTTTAGTAGCCACAACCTGAATTATTTATCCTGATAAAGTTTGCTACTGTACTGGGTTACATTATGT
GTAACCTCCGCCTTGCCCTACTTTGTTCAAGTGTGAATTCGTACCCCTCATCGTTTTGCGTCCATTCATCGATCAGTTCCCAAGCAGCAATGGCCGATCT
GGAGCAGCAAGCGACGCCCTCTACCGAGACTGTGGAGGCTGCAACCGCCGCCACGCCAACTTCTACAGAAGCTCCTGTGCACGAGCGTCGTGTGGGCGAA
GCTCCTATTAAACCAGAGTGCGTACAACCCTCGGTATCATTTGAAGTGTATCATCGACTAGCTTACCACTCTACCATTCACAGGTTCCTAAAGCCCAAGC
CAGCCTCCAAACCTGACAATAGAGATGTGAAAAAAGAAGCAAACGACCGCGACAGCAAGAAGAAACGCGGAGGAACCTTCAAGAAGCGTCCGGCCGATGT
CGAGCAAGACCCCGCTGACTGCCTATGCCGACCCGTGGCTTCCGGCGAGAACTGCAAATTTGGCGACAGCTGTAAGTTTAGCCACGACATCAACGACTAC
ATGAAGCGGAAGCCCAAGGACCTGGGTGAGAGCTGCCCCGTGTTTGATGTTGTGGGCTACTGCCGCTACGGTGTGGCGTGTCGATTTGCCAATGCTCACA
TTGAGAAGGCTGATGGCAGCTACCGTAACGTAAAGCGTGACGGATATGTGGATGGCACGGAGTTGGTCGACGAGGTGAATGATCTAAACCATGACCTCAG
ATTGAAATTGCGTAAGGACACGTACGATTTCCAGTCCAAGCAACAGCAGAAGAAAAAGGGAAGGAAGTCTGCACCTAGGAAAGCGAATCCTGAGTCTGAA
GAAACCAAAGCGAAGCCTGAGGCTGAAGATGCTCAAGCGAAGCCTGAAATTGAAGATGTGGAACCCGCTGCTGAAAGTCCGCAGCGCAAGCCTATTGACT
TCAAGCAGAAGATCTACATTGCCCCGCTCACTACCGTCGGCAACCTGCCGTTCCGCCGCTTGATGAAGCAAACCGGTGCTGATATCACGTGCGGTGAGAT
GGCTATGGCTACGAACCTGCTGAAGGCACAGCAGTCCGAGTGGGCATTGCTGCGACGCCACAAGAGCGAGGACGTTTTCGGTGTGCAGCTTGCAGGTTCC
TTCAGCGATCAAATGGCTCGTACTTGCGAGCTTCTTGCTCGGGAGACAGATATCGATTTCGTGGATATCAACATGGGTTGCCCCATCGATGTTGTGTGCA
ATTCTGGCGCAGGGTCTGCTCTTATGACCCGCCCACCGCGGTTACTCGAGGTCGTTGCTGGTGCTTTGACCGGTCTCGAGCTGGGCACGCGCATGCGTAC
TGGAGATACCGTGAACACACCGGGTCTTACTGTAAAACTGCGTACGGGTTGGAGCGAGAAGCAACCGACTGCCCACAAGCTGGTACCTAAGCTGCAGGCT
GTGCGTGCCTCGCAAGCATACGTGAACGCTGCGGTTGTCACTGCTGACTTTAAACTGCGTGCTACCCAGTCCGTTGACGCCATTATGGTACACGGCCGTT
CCCGGTTACAGCGCTACACGAAGAATGCCGACTGGGATTACATTTTCCAGTGCAGTGACGCCCAAGTGGACAGCAGAGACGAGAAGCCGTTGTCGCATGT
GCCGTTCGTGGGAGGCGGTGACGTCCTGTCGTACGAGGAGTTCGATGAACACTTGCAAAACGGCAAGCTGGACACGTGTATGCTGGCTCGAGGTGCATTG
ATCAAGCCCTGGTTGCCCACGGAGATCAAGGAGCGCCGCCACTGGGATATTTCGGCTTCAGAACGCTTGGACTTGCTCAAGGACTTCGTTCGTTTCGGGC
TGGAGCACTGGGGTTCGGACCAAAAGGGCGTGAACCGTACGCGCCGCTACTTGCTCGAGTGGCAGTCGTTCCTGTGCCGGTACATCCCCGTGGGCCTGCT
GGAGACGCTCCCTCAACGTATCAACGACCGCCCGTCGCCGTATTACGGACGCAACGGGCTCGAGTCATTGATGGCCAGTGATCAAGCAGCGGACTGGGTC
AAGATTTCCGAGATGCTGCTTGGCCCCGTGCCCGACGGCTTCCAGTTTGTGCCCAAGCACCGTGCCAACGCGTACCAGGCCTCGTAAAACGCAAGATTGA
CGAATGAGTTGCTGAACATCGCAACTTTGGCAACATGAACTGTTGAGTGGGTGAGTCAGCAGAGAATGTTCGGTTGACCCAACAAAATAGAGCAACCAAG
ATGCCAGGGCCTGCCCAGCAGGTTGCTGGGCGTTGACCTGAAGACCTTGACACTGTCAAGTTGACAAAACTGCACCGTCGCGTGAGCTTGAACTTGTAAG
TTATCTTTGATGTGTGGAACTTCCAAGTGGAAACTTACCAAATAAAAACTTATGCGAAAGACTTTACATGTCATGGATAACGTTAGTACAAAACCATTTT
ACCATTGAAAGAAGAGAACAGTACTTGAGCCAAAGGAAAGAAGAAAGTGCTTATAGTTGAGGTGGCAGTGTGAAGTGACGGGGACGGCGTGGCAATGCTG
CCCTCAAGTTGATCATGACTCATGAGTGAATCACAAGTCATACATGCATATGCATAAGTACACCGTGTGGAAGCAAGAACAAGCACCAGCTTTTCTAGAA
GAAGAACACTACGAGATCTTCGCATTCCGCATCTTTACGAAGATCTGATAGCTTTATTAATACAAGTAACTTTCTTCACTAAACAGGGCAGATTTACATA
CATACTACACCGTCGCAGTTTTGGCTGGTCGCCAAGCCCGGTACCATCTCAAATCCAAAGTATCTTTAGAGCCCATGACCAAGTTGGTCACCAACCGCAG
AAACTCTATCTGTACAGCACAGAAGCTTGGCAATCAAGCGTCCCCTCCCTGAAATGGTATCAGTCACTCGTATCACGTAGCACAGGGCGACACATACAAA
AACCAAGTACCGTATAGCCCGCTGCTGCGAAGAGACAGCTAAGCTGGCCCCCTCTCACGCTGTGCCGCCCAGCTCAGCACTAACCGATCGGCTGTCGAGA
CCGCGCGCACTTCTCCCCCTCGCCCGATGCTCGAGAGCAAGCCGGATCCCCTGGTCAGCGCGGAGCCCATGGGCAGCAGCTCCAGCCTCACGCGCCTGTC
GAGCGGCGTGCTGCCCCCGCCGCGCCTGAACGTCGGCGTTTTCTCCAAGCGCAAGGGCGTCCGTTACCATCGTGACGGACAAGTAAGCAGCTGCCGCTTC
TGCGAGATCCTGCGGACGCGCGCCGAGCCATTCCTGTACGAGGACGAGCGCGTGGTCGTCTTCCGCCCGCTCAGGCCCATCGTGCCCAGCCACGTGCTCA
TTGTGCCGCGCGCGCACATCCGCAACGTCAATCGATTGGCCGCCAGGCATCGCGAACTGGTCGCGAGGATGCATCGCGTGGCGGAGGCTGTTATGACCAA
AGGATCGGACAACGGAGCCGTTGAGGACTATGTGGAGCAGCCAGAGGAACCAGAGGAGGTCCACACTCAAGGGGATGAGAACCCCGTGCGCTACTCGTTC
CACGTGCCACCGTTCAACAGCATCGACCACGTCCATATGCACGCGTTCCTCGACGACCCGCGTCGTCTGGGCTACTACGGACGCATTAAGTACCGGACCG
AGTCGTGGTGGTGTCGCTCGTACGACCAGGTGATGGCCAGACTGACGGAACTGGCCGCCGACGTTCCGCAAGGCCA