Description :
From Genome Similarity Track
Location :
Scaffold_369:1833- 3230
Transcript NameFunction/comments
g16208.t1hypothetical protein

Sequence
1397 bases(100 bases per row)
TTCGCCGGCGGGTTTTACCCGCGGGCGCACGCGTTCAAGCCCGGCTTGATCGCGCATCGCATCGTCGTGCAGCCCGGCTGCACGCGAGCTCGCAAGCATT
TCCGGTGCGGGACGTTTGCAACCGTCCGCACTGCTTGTAGCGTCGGCTCCCAGAGCCGACACGCCTTCTTTACCTCTACGCCTAACAGCGGAGTGTCTTT
TGACAAATTGTGTGTCGACATTATCTGTCGACACGACCGCGTTGCTTCGAGACCCCCTTGAATCCGATCGAATCAGGCCCTGCTGATTCGGTTCACGTTT
CTTTCCAACGACTCTCGCTGTAGCGGGGCTACACAGTCGGTTCACCTCCTACCTTAGTGCAACATGCACTATTGGATACATTCAGGTTGACCACTCCACA
GGGTGGTCCACATTCATAGCAAACGCATATGACTGGTAGAAAGCAACATCTTTCTACCAATGAGAGTCATTCAATAGATAGGGGTTCTGCCATCCATCCA
ATGGCAGAACCTTTCATTAGAAATATCAGTTTTAGGAGGAAACCCCATTTACAATCAATACAGTTCTCATTTTACACCAAAGCTATCGTTCGGTTCCTTT
GTCTTAGTTTAAATATACTTGCGGATACAAGTATACTGAACTTAAGTTAAATACACCAACGCTTCCTCATACACGTGCGCACACGTGTAAGCTAAAGTAG
TGGGTCTAAGCAGACCCATTACACTCGCAGTCGTTGTTGTCCGCGCGGGGTGATCGGAGACAGTCGCATCCCGCGCTGGTTCTGGTGGAGGGCCGCATGC
ACCACGTGGTGCATGTGCTGCGCCGACAGGGCCATCGCTCTCTGTCGCGCTGCTGCTGCTCCTGAAGTGCTCGATCGTGCGCTTCGTCCAGTCGATCACC
GGATCATGCCGTGCAAGCCACGGCATGCCCAACACCATATCGAACTTATCGTCCAGTTCCAGGACGATAAGCTCGTCAACGAACTCCTTCTCTTGATATG
AGAAGCGTACGCATACGATACGCTTCTCGGTTCTAACAACGACACCTGTTGCTAGCCTCACTTCCAATAGACTTCGAGGTGTTTTCACTTCATCGAAGTC
AAGCCTTGGAAGGCTCTGCAGTCGAACAAAGTTGTTCGGCGCTCCACAGTCCACTAGAGCACGAAGAGACTTCTCCTTCTTCGAGCTTACCTTCAGGATG
ACAAGGTTCGTCTTGTCATCTTGCTTCTTGCAGTGAGATTGACTATCGCTGGGGGCAGCGATCTTCATTGCAGCGTGTCCGATGTCGACACGCTCGACCG
CATCACCAGCAGGCGCGGGGCGCCCTGCTGGTCCCTCTAGTTTTTTTATTGCCCGTGATGATACCCAGTATCGCCACGACGGCTCCTCGCCGCGTGC