Description :
From Genome Similarity Track
Location :
Scaffold_39:183297- 184711
Sequence
1414 bases(100 bases per row)
AGGCCGGACTACGAGTTAACTCATGTCACGACAGTGACGTCGTCAGTGCCTGACTTGATACGCGGAGCGTATGCACAAGACGACATGTGCGTAGCGCTGC
TACGGGCTCTTGGGAGCGAAGAGTTTAAAGACTCTGACAAGGAATTGTCTGGGCGCTTACGCGCGAGGCTGCATCGATACTCGCTCGATGGCGGCCTGCT
GTACTACAGCACCGACTCCGAGGATAACCTTCGTGTAGTCGTTCCTCATGATGAGGATCTTAAGTATCGAATCCTCTATGAGGTTCATGATACGCCCGTG
GGCGGGCACTTAGGTCGATAGAAGACCTATGGCTCGGTGAGCTCGATGTACTGGTGGCCCACGATGTATAAATGGATCGGCACCTATGTACGCACGTGTG
AGACGTGTCAACGGACAAAGTCCGCGCCGAGCACGGCAGCGCCATTGGCGAGTTTGCCTGTCCCCAAGGGATGTTGGCAGTCCATGAGTATGGACTTTGT
GTTTGGCCTTCCCAAGGATAAGGCGGGAAACACGGGTATTGTGGTCTTTGTAGATCGATTGAGCAAGATGGCTCATTTAGCGGCGGTGCCGGACACCATT
AATGGTGAAGGTACAGCTTTGCTGTTTTTAGACCGAGTCTTTTGCCAACATGGCTTGCCTGAGGCAATTGTCTCGGATCGAGACCCGCGCTTCACCGGAA
AGTTCTGGACGTCCCTCTTCAGAGTGCTCGGCACTCGTTTGGGCATGTCCACAGCAGACCATCCGCAGACCGATGGTCAAACCGAACGCGTGAATCGCGT
TGTGGAGGGTATCCTCCGAAGCGTATGCGCTGAGGCGCCAAAACGCTGGAGCCAGATGCTCCCACTCGTTGAGTTTGCATTAAATAATGCAGTGCATGCC
TCACTCCGTTCTACGTGAACAGCTTGGTGAGCCCTCGCGTTCCACTGACGCCGCCACGCAGTGGCTCAGAGCTTGATGGGGGAGGGATAGCCGAGCAGCT
AGCTGATGTCAGCCCTGTTGCGGTTCGCAGGTAAGTCGACGACTTTGTCTTTTTAAAACGGAGCGTAATGCGTCAAGTACGCGACGCTATCGCTGAAAGC
CAAGACACGCTGAAGGAACATGCAGATACCAAGGGCAGAAGCAATGTTGAGAGGTTTGAGGTCGGTGACCAAGTTTTATTAAACGCTAATAACCTACCTA
CTCATGCAGTGTCTGCAGTCTTCAAGACGAAGCTGAGACCTCGGCTTATAGGACCGCTCAAGGTCGTGGCCAGGAAGGGCCTAGCGTATACGCTCAACCT
TCCGAAGAAGATGCGCACGCATCCGGTCTTCTATATTGGCTTGCTTAAGCCATATCAAGACCCTGCTCAGGTGAGCGCGGAGGCATTAACGTCAACGGTG
GATGGACCACGGAC