Description :
From Genome Similarity Track
Location :
Scaffold_123:18328- 19865
Transcript NameFunction/comments
Phymu_g4888dihydrodipicolinate synthase putative
Phymu_g4889hypothetical protein PHYSODRAFT_295492

Sequence
1537 bases(100 bases per row)
GCACACACGTACGGCGGAGCAATGACCAAGCAGGCATCTGCGCCTAATTCCTTCGCTTCTTGAGCCAATTTCACGGCTCCATCGGTAGAGAGCGAGCCAG
TGCCTGCAATCACTGGCACTCGACCATTGACACGTTTGAGGACGATCTTGATCACTTGCAAGCGCTCCTCATCCGATACGAGCGTGTTTTCGCCCGTAGA
TCCCATCTACAGATACATTCATTCCCTTTTATTTATTAATATAAACTTTGTATGGAGAAGTGACAAGAACTTACGGGGACGAGACCGTCGATGCCTTGCT
GGATCTGCCACTCGACCATCCTCTCCAGACTCTCGTAGTCCACAGCTGACCCATCGGGGGTGAACGGAGTCACCAAAGCCGTGTACGTCCCGTCGAATCG
CAGTGTCGAGGCCATCGCTGAAGCAAAAGATCTTGTCCGGGCAGTGCCGATTGAATTGTGTGCTCTTGAGCGCACAGCCCAAGACTGGCGTAGAAACTGT
TTAAACATGGAGAAAAACTCGGAATGAAAGGATGAAAGCTGAGTCTTCCATCTAAACACTGGCAGTGATGAGGATCTCACCTATTCCCCGCTAACGCACT
GGAAGATTGCATGAGTCACATGTGACATATTGAAGATTGTTCAATACAATAgattgtattgtattgtgACTACAATTTTATTCCGACCTGAGGAAGATAT
CCTTGTACTTGATCTGCACCTCCTTGAAGCCGATGGGTTTGCGGCCagtgagcttctccacagcGTCAGACACTGGGGTCATGCAGCCATTCGCCATCAT
CTCACCGCAACAGAGCAAGTCGCCAATACACAACTTCATGGGGAGGTGGGAGAAATCGCCGTACACGTCCTTAGGGAGGCCGCGGTCCAGCCACCACTtg
cgcagctcttcgtcggGCAGGTCAACCAGCTCCCCTTTGTAGCCCGAAATGCTGTTCATGAACTCGAAGACTTCTTCGTTGGAAACCGGTTCCGGACCGG
TGATTTCGTACACCGTATTCGGTTCACCTCGGCCGAGAAGCAACGCACCGAGGGCGCGTCCACAGTCGTCGCGAGCCACGTAGCATCCTTTCTGGCCGTG
GCTGTTGGTCAGCCACTTGTCGCCGCAGAACTTCCACGACGGAGCGAAGTACATTGGGATATTATCCGCGTACAGGCAGTTGCGTTGGATATTATACTGC
AGTCCGGACGCGTAGATCAACTGCTCAATGTAGTGGTGATCGCGCAGAAGGTAAGGAATAtcctcctccgtctcagCCTGCACGCCCGCGCCAGCTCCCG
ACGTGTagcagaagcgcttcactCCCAACTCCTTGGCCGCATCCAGAGCGTTCTTGATCTGATTCCGACGACGGTCTCCGATCAGCCACGTCGAAATGGT
CGCAACGGCCTCTGCACCTTCAAAGATCTTCTTCATACTatcgacgtcgtcgtagcTGGCAAACACCACCTCGACGCCCTTGCTACGCCATCGAGCCACC
TTTTCCGCTGGGATTTTAtccaaactgctgcttgcca