Description :
From Genome Similarity Track
Location :
Scaffold_13:183231- 187943
Transcript NameFunction/comments
g18340.t1POM59384.1 DnaJ domain containing hypothetical protein [Phytophthora palmivora var. palmivora
g18341.t1XP_009528624.1 hypothetical protein PHYSODRAFT_504737 [Phytophthora sojae

Sequence
4712 bases(100 bases per row)
CGGAGGCTCGGAAGGAGGACGCCGCGTACTGGCGCCAGTTCGAGCGCGACTACTACGCGCTGCTGGGCGTCCCGCGCGACGCGTCGAACGACGAGATCCG
CAGCCGCTTCTTGTCGCTCTCGCGCGAGTTCCACCCGGACCGCCACCCGCGGCGCCACGGCAACGCGGCGCTCGTGGCGGCCGCCAACGCGCAGTACGCG
GTGCTGGACCGAGCCTACAAGGTGCTCTTCGATCCGGTGAAGCGCCGCGTGTACGACGTCTACGGCGAGAAGGTACGACCCGTCTAAATGAACCAAGGGT
GCACTTATGACTGAGGCTGGTACTTTTCTATAGGGAGTGCACGCGCTGGAACAGGATGGAGCTGCGCGGCAGCAGGTTGTGGGGGCGCACCTCAAGACGT
CAGACGAGGTGCAGCGCTGCGTGGAGCAGATCATGCGCCGCATGAACCAGCAGAATCTGGAGGCGCAGTTCTCGTCCTATAGTGAGATGTCCATGCACGT
GGACGCGTCCGACTTGGTGCAGGCGCCCATGCAGGGGTTGCGCAGCTTGTTCCACAGTGGCGCGAGGTTCGTGGACCGCACGGAGATGACGATTCACCAG
CGGACAGCGTTCCCGCTCTCGCGCAGTACGACGCTGACACTGGGAGGCTACATGTACGACAAGATGGGGCTGGGCATGGGCAGCTTCACGGCGCAGTTGG
CGCACACGTCGTTTGACCCGAGCGTGCCGTCGTTCACGCTTACGAGTGAGATGGGCTGGGCGCCGAAGCTGCACTGCCAGATCAGCCAGCCGGTGTCGCC
CCACACGGTCTTCATGCTCATCCCGGAGGTCGATGACAACGGCCTGGACATCTCGCTGGGCGCCAACCAGTTGCTGACGCCGCAGCTTCACGGCGCCATG
ATGTGGAGCACGCGGGACGGTCTTTCCGGGTCGCTGAGCCAGGATACTGCAACGTACAACGCCACGGCAGCCGTCGCCGTGAATGGCGGAGGCCCCAACG
TGTCGTTCCAGTTCCGCCGCGTTCTGATGGCCACGACGGCTAAACTGTCGCTGCGTGCCAGTCTTGCCACGGGCTTGTCGTTCGTTGCGGGAGCTAGTCG
AGAAATTTCCAACCGGACCCGGTTGGGTCTGGGTGTCTTGTTGGCACGCGCAGGTGTTACTCTGCGTCTGGGTTTCACTCGTGGCAGCGTACGCTTCGTA
ATGCCCATTTTCCTGTCGCCGTTCTCCGCACAATCGGCTTTCTCTACGTTCTGTGCCGCCACTTCGCCGTTCGTGGTAGCTGCCGTCGTTACGCAGCTCG
TGAGGCCTGCACAAGAGCGCCAGCGACGTCTGGAGTTGGAGCACCGACATGACGTGCGTGTGCAGTATCTTGCTGCGGCTCGACAGGGCGCACTGGAGCA
ACAAAAGCTGATGCTGCGTTGCGCAAAGGAGAAGATGGAGCAGGAGCAGCAGCGGGAAGATGCAAAGGGATTGGTGATTTTGCTGGGTCGATACGGCAAC
AACCCGACGAGTCCCGACTCGCGTGAGTCCCGAGAAGATGACCTGGGTGTAGCGTTGCGGGCAATGCGAGAGCGGGACTTGAATCGCGAGGATAGCAACG
ATACCGAATCTGGCAGCGCTGACAGTGCCATTCAGCAGGAAGCAGACGCCGAGTTGCTGGAGCAGAAGTGGGTCGATGTTACGATTCCTCTTCAGTTCTT
TGTCAAGGTACGGAAGTCTGGAGGTGTTGCAATATCGAGGAGGGTTTTTCTAACTTAGTTGTGTTCACACTATGACATCCAGGACGGAGAACTTGCGCTG
ACTTCGTCATCGAAGGCTGGCCTCCTCGGATTTTACAATCCGTGCATTGGTGAAGACCAAACCATTGCCGACGCTCGATCATCATCAAGCTCCGCCGTTA
AGCCGTTGCTGTAAGTATTTTTTTTATGTTTCTGGGTCTGCACTCCGTTGCAGCTGACTAATGTCTTACGTTGTTTTTGCTATGCTGCAGCTATGTGCGC
TATGCGTACGATGACCAGGTGTTTGAAGCTACGTTCGATGACGACCAAGTGGTTAGTTTGCCGTCTCGGTACGCCCAGATAATGGGCCCCGTCGGGAGTG
TGTACTAGACTACGTGACATAGAGGAGTGGGTACATTCGCGTTAGAGACTCCGTGTCGTGGATTATTTTGGAATGTTCATACTGATGGATGAGTTTCCAA
CCTCACTGACTGCATGAATTTGTCCACTAGCACGTGCAGAGGCAGATCTTGAGGTGTCAATTGTTTAGTCTCCTTCTTTGAAGACTCTAGCGCCAGGTGC
TGCTTCGTGAAGAGCACGACGGCAACAGCATCCAAGAACTCCGAGAACACCAGTGTCGTGCCCACAAAGAAAGCGTCTGGTTCGCCATCGTCGTTGCTTT
CGCTCGAGTTGGATCCAACGATACTGCGGAGTAAGCCGGGCTTGAGCGGTGGGGAAGAGGATGTGAAAGCTCGGTTTAGCGCTGACAGCGCATCGCGGAT
TTGAAAGTCCGCAGTGAAGATAGGCGCTTCCGGGGAAGCATCGTTCCGGAGCATGACAAGCACCGATCGAATGGATACCTCTTCTACGTGCGTATTCAAC
GGCAATTGGGGTTCCTGCTCTCCATGCTCGTGCTCTGATACGTCTTCGTGCTGGCGAAGAACTGAAGGCGCTGCGCAGCTGCAGTACAAGTCTTGAAGGC
GGTCGTGGTGTTTTGTAAAGATGCTGTGCAGCTTCTTCCCCATCAACTCGGCGCGCAGAAGCGCTAACCATGTCGGCGGGCTCTGGCTCAATGTTTCTTG
ACGCTCGCGCATCATTTGATCGTACAGGTCGGAGAAAACGTCCGCTAGGAACGCCGTGCTGTCGCTACTTGTAGCGAGATCGATCACACCTTCGGCCTCT
GCTGTCATCACCCACGAATGTGCAATGCGAACAAGCAGCTCGACAAATTCTCGGAAGAGCAGCAATTCGTCCCAAGGTACGACTTCAAGCCGAGTTGGAT
CTATCGGGTGTCTGGAACGATGTTCATGCGGCAGGTCATCCAGGAAATGCTCGGCCATGTTCATCGACGCTGCGCAGGCCAAAGCACTTGCTCGCTGAGC
TCTTCGGACGTCCTGCATCAAACTCTCGAGCCGTCCACTAGGAAAGTAAAAGCCGCATTGAGAGAGTAGTTGCTGACACTCGAAGACCTCGAGCAATGTC
CCGGTATCATCTGGATCATTGGCAGCAGAGGCTGAAGCCCGCCGAGACTCCTTAATGCACCCGCGATAAAGCGAGCGCAACTCAGTATTAATGCGCAGCG
CTGCGTGCTCCACAGCCTTCCGAGCGTTTTCACGCTTTGGGGCGTCCACTATCGGTAGCAGATCGTTGACAAACAGAGCGATACCCGCGACACTCGAAGA
CGACGAAGGTGACTGGGAAGGTGACAATGCTGTCGCTGGGGCTGTTGGGGCTGTCGGTGCCACAAAAGGCGCGGGCGAAGCAGGTGCATGAAGTCCTGCA
GTCGCTGCAGTTGCGTAGGAACCTTCGAGGCTGCGATCCTGGCGGAACTGTCCTACGAATACGCGACCGTCCTCGTAGAAGAAGAGCCCATAACCGTCTT
TGACGTTGGCCTTCCACTCGCCTTCATACCTCGCGCCGTTGGCATAGAAGAAAACACCACGTCCATGGCGAAGCCCTTCGTGGAACTCCCCTTCGTACCA
GTTCTTGTCGTGCGGACTAGAGATGGACGATCTCATTCTAGTGGGAGACACCGTCGATAACGAGCTGAGTGGACTCACTAGCCAAACATGTCGCCCAAAA
CCATGCTGGCAGTCGTTTACCCACTCGCCGTCGTATCTCTCCAGCGGCATGGCATCCTCAGGATTCGAGAGCTCGTCCACGCCTGGTGGAGCCATCCACG
TCATCACACCTCGTCCACACTTGACGTCAGCTTGCCAGTCTCCTGTGTAGACACTGCCATCCGCGTAGTGCATGTGTCCATTGCCCTCGCGCTTGCCCCC
TACAAATTGCCCCTCGTAGCGAATGTTGCGCGCAGCGTCGAACACCAGCTCGCCATACCCGTGTGGAAGTCCATTCTCCCACTCCCCATCATAGCGAGCA
TTACTCTGAGCCAGTACAAGACCAGTATCCAACCCGATATCCCCTTTGTTGTCATCATGGACGGCTCCATCTTCTTCTGCATCGTGCTCCATGACATTTG
GGTTATCAGTAGTGGAGCGGTAGGCAAACAGTAATGGCTTTGGCGTTTCTCCTCCTGTTTCGCCTGCCTCCTGCTCATGAGCTTCTTCACTGTTTGACTG
CTGCAGCAGAACTCCGCGGTCCCCAGTCACGAACACGCCACGACCATGTCGCTTCCCGCTCTTGACATCTCCGACGTACGAGCTGCCGTTCGGCCACCAG
TACGTCCCTCGTCCCGTGATCTCATTGTGTGTGAATTCTCCCTCATACACCACACCGCTATCATGCCACTCGATGCGTCCTGGGCCATGCATACGTCCAT
GAACGAAGTCCCCTACGTACGTGAAGCCCGTCTTGAATTCCAGTCGCCCCTTCCCATGGTACACCGGCACATCGCACTCCACCACCTGCAGCGTGTCCCC
CTCATACGATCGAACCACATTCGCCAGCACCCGAGGGTCCAATGGAGACGACTTCATCCACGACACCATAGGCTCCAACTTCACCGTCCGTTATCGTTGT
GCACACGAAGCG