Description :
From Genome Similarity Track
Location :
Scaffold_119:183229- 189601
Sequence
6372 bases(100 bases per row)
GCCACACGTAGATGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGATCTTGGTTACTTCATAGTGAGACTTACTGC
TCGGCGGGCGGAGTAGACGCTGATCTTCTCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATACCCGGGACGACTACAGGTCA
CTTGCTCTCCACAAAGCAAATTGAGGTCTGTATTAATTGATTTAGTCCCTAGGGTCGAAGTATACCCGAAACTTGTCCGGGCCAATGCTCATCTCATCTA
CGATTGCCATGCGAGGCCAAATCCAATCTTTGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCACTTGTTCTCT
AGTTTGTGATCTTGGTTAATCTATAGTAAGCGTACTGCTTGGCGGGCGGAGTAGACGCTGATCTTCCCATGGCCAATATTCACCCCTGTTAGGGAGATCG
TCCGAGGCCAAATTCAATACCCGGGACCACTGCAGGTCCCTTGCTCTCCACAAAGAAAATTGAGGTCTGTATTAATTGATTTAGTCCCTAGGGTCGAAGT
ATACACGAAACTTGTCCGGGCCAATGCTCATCTCATCTACGACTGTCAGGCGAGGCCAAATCCAATTCCCGTCTAAACGCCACACGTAGTTGGTCCTCCA
CTTTGATGTTCCCGTTACGATTCCTTGGCCCACTTGGTCCTCTAGTTGGTGATCTTGGTTACTTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGAC
GCTGATCTTCTCATGGGCAATATCCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATTCCCGGGACCACTACAGGTCCCTTGCGTCTCCACAAAG
AAAATTGAGGTCTGTATTAATTGATTTAGGCCCTAGGGTCGAAGTATACCCGAAACTTGTCCGGGCCAATGCTCATATCATCTACGATTGCCATGCGAGG
CCAAATCCAGCTCCCGTCTAAACGCCACACGTAGTTGTTCTCTACTTGATGTTCCCGTTACGATTCCGTGCCCACTTGTTCTCAAGTTGGTGATCTTGGT
TACTTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGACGCCGAGCTTCCCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCA
ATCCCCGGGACCACTACAGGTCCCTTGCTCTCCACAAAGCAAATTGAGGTCTGTATTAATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTC
CGGGCCAATGCTCATCTCATCTACGATTGCCATGCGAGGCCAAATCCAATCTTTGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTAC
GATTCCGTGCCCACTTGTTCTCTAGTTTGTGATCTTGGTTAATCTATAGTAAGCGTACTGCTTGGCGGGCGGAGTAGACGCTGATCTTCCCATGGCCAAT
ATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATACCCGAGACCACTACAGGTCCTTGCTCTCCACAAGCAAATGAGGTCTGTATTGATTGAT
TTAGTCCTAGAGTCGAGATATACACAAAACTGGTCCCGGACCAATGCTATTTTCCAGTTAGATTGGCCCTGGGGAGACCCATCTCCAAATTTTGTAGAAA
ACGCCAAAGGTGGAGTTTTCTCCACTTAGTTTTACGCTTACGTTTCCGTGCCCCACTTATTCAATAGTGGGTGTATTCTGGGTTTACTTCCTAAGGAAAA
TTTTCTGCTCGGCGGGGCGGAGTAGACGCTGATCTTCTCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATACCCGGGACGAC
TACAGGTCACTTGCTCTCCACAAAGAAAATTGAGGTCTGTATTAATTGATTTAGGCCCTAGGGTCGAAGTATACCCGAAACTTGTCCGGGCCAATGCTCA
TATCATCTACGATTGCCATGCGAGGCCAAATCCAATCTTTGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCAC
TTGAACTCTAGTTGGTGATCTTGGTTAATCTATAGTAAGCGTACTGCCTGGCGGGCGGAGTAGACGCTGATCTTCCCATGGGCAATATTCACCCCTGTTA
GGGAGATCGTCCGAGGCCAAATTCAATACCCGGGACCACTTCGCAGGTCCCTTGCTCTCCACAAAGAAAATTGAGGTCTGTATTAATTGATTTAGTCCCT
AGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCATCTACGACTGTCAGGCGAGGCCAAATCCAATTCCCGTCTAAACGCCACACGTAG
TTGTTCTCCACTTGATATTCCCGCTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTAATCTTGGTTACTTCATAGTGAGACTTACTGCTCGGCGGGCGG
AGTAGACGCTGATCTTCCCATGGCCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATCCCCGGGACCACTACAGGTCCCTTGCTCTCC
ACAAAGAAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCAT
GCGAGGCCAAATCCAATTCCCGTCTAAACGCCACACGTAGTTGTTCTCCACTTGATATTCCCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGAT
CTTGGTTACTTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGACGCTGATCTTCTCATGGCCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCC
AAATTCAATCCCCGGGACGACTACAGGTCACTTGCTCTCCACAAAGCAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAA
ACTTGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCGAGGCCAAATCCAATCCCCGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTC
CCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGATCTCGGTTACTTCATAGTGAGACTTAATGCTTGGCGGGTGAAGTAGACGCTGAGCTTCCCA
TGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTTAATCCCCGGGACGACTACAGGTCACTTGCTCTCCACAAACCAAATTGAGGTCTGT
ATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCGAGGCCAAATCCAATCTTT
GTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGATCTTGGTTACTTCATAGTGAGA
CTTACTGCTCGGCGGGCGGAGTAGACGCTGAGCTTCCCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATACCCGGGACGACT
ACAGGTCACTTGCTCTCCACAAAGAAAATTGAGGTCTGTATTAATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCAT
CTCAGCTACGATTGTCATGCGAGGCCAAATTCAATCCCCGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCACT
TGTTCTCTAGTTGGTGATCTTGGTTACTTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGACGCTGATCTTCCCATGGCAATATTCACCCCTGTTAG
GGAGATCGTCCGAGGCCAAATTCAATCCCGGGACGACTACAGGTCACTTGCTCTCCACAAAGCAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGG
TCGAAGTATACACGAAACTTGTCCGGGGCAATGCTCATCTCAGCTACGATTGCCATGCGAGGCCAAATCCAATCCCCGTCGAAACGCCACACGTAGTTGT
TCTCCACTTGATGTTCCCGTTACGATTCCATGCCCACTTGTTCTCTAGTTGGTGATCTCGGTTACTTCATAGTGAGACTTAATGCTTGGCGGGCGGAGTA
GACGCTGAGCTTCCCATGGCCAATATTTACCGCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATCCCCGGGACGACTACAGGTCACTTGCTCTCCACAA
AGCAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCGA
GGCCAAATCCAATTCCCGTCTAAACGCCACACGTAGTTGTTCTCCACTTGATATTCCCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGATCTTG
GTTAATCTATAGTAAGCGTACTGCTCGGCGGGCGGGGTAGACGCTGATCTTCCCATGGCCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATT
CAATACCCGGGACCACTACAGGTCCCTTGCTCTCCACAAAGAAAATTGAGGTCTGTATTAATTGATTTAGGCCCTAGGGTCGAAGTATACACGAAACTTG
TCTGGGCCAATGCTTATCTCAGCTACGACTGTCAGGCGAGGCCAAATCCAATCCCCGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTT
GCGATTCCGTGCCCACTTGTTCTCTAGTTTGTGATCTTGGTTAATCTATAGTAAGCGTACTGCTCGGCGGGCGGAGTAGACGCTGATCTTCCCATGGCAA
TATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATACCCGGGACGACTACAGGTCACTTGCTCTCCAAAAAGCAAATTGAGGTCTGTATTGAT
TGATTTAGTCCCTAGGGTCGAAGTATACACGAAAATATGTCCGGGCCAATGCTCATCTCAGCTACGATTGTCATGCGAGGCCAAATTCAATCCCCGTCGA
AACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGATCTCGGTTACTTCATCGTGAGACTTAA
TGCTTGGCGGGCGGAGTAGACGCTGAGCTTCCCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATCCCCGGGACGACTACAGG
TCACTTGCTCTCCACAAAGCAAATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACACGAAACTTGTCCGGGCCAATGCTCATCTCAG
CTACGATTGCCATGCGAGGCCAAATCCAATCTTTGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCTACTTGTTC
TCTAGTTGATGATCTTGGTTACTTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGACGCTGATCTTCCCATGGCAATATTCACCCCTGTTAGGGAGA
TCGTCCGAGGCCAAATTCAATACCCGGGACCACTACAGGTCCCTTGCTCTCCACAAAGAAAATTGAGGTCTGTATTAATTGATTTAGGCCCTAGGGTCGA
AGTATACCCGAAACTTGTCCGGGCCAATGCTCATCTCATCTACGATTGCCATGCGAGGCCAAATCCAATCTTTGTCGAAACGCCACACGTAGTTGTTCTC
CACTTGATGTTCCCGTTACGATTCCATGCCCACTTGTTCTCTAGTTGGTGATCTCGGTTACTTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGACG
CTGCGCTTCCCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATACCCGGGACCACTACAGGTCCCTTGCTCTCCACAAAGCAA
ATTGAGGTCTGTATTGATTGATTTAGTCCCTAGGGTCGAAGTATACCCGAAACTTGTCCGGGCCAATGCTCATCTCATCTACGATTGCCATGCGAGGCCA
AATCCAATCCCCGTCGAAACGCCACACGTAGTTGTTCTCCACTTGATGTTCCCGTTACGATTCCGTGCCCACTTGTTCTCTAGTTGGTGATCTTGGTTAC
TTCATAGTGAGACTTACTGCTCGGCGGGCGGAGTAGACGCTGATCTTCTCATGGCAATATTCACCCCTGTTAGGGAGATCGTCCGAGGCCAAATTCAATC
CCCGGGACGACTACAGGTCACTTGCTCTCCACAAAGCAAATTGAGGTCTGTATTGATTTATTTAGTCCCTAG