Description :
From Genome Similarity Track
Location :
Scaffold_30:183220- 187292
Sequence
4072 bases(100 bases per row)
ACGCAAATTGATGGATCCGCCAGCACCAATAGAACATATCCCATTCTAAATCTAGTATCTGCAATTGATCTCACTGCACAAGTAGGTGGTGTTTCAGCTA
CAAGCGCTGACTTATTTAATATCAACTGGAATGATAAACTATCGGGTCGGTTTTACGTCTCAGACGCATAGATTCTGCTTCAATGTTGGCAATAGTCAGC
CTTATAAAAGTGGATTTCCTCATTCATATACTCTTGCAACTTCAGCGGATGCCTTTTGTATAACTCCTGCTGGTTCATTCCCTACACCAGCGGCTGGATG
TCTCTACCTTGTTTCCGACACTGTTAATAAGATGATATTCGATTTGAATACGCCATACACCAGTTCATTTGGAACAGCGCCAGTTTTACTGAATTCTGGC
AATATCTACATAAAGGCATCTAACGCATTAAACGATGGATCTGCAAACTTCGATATGCTCATTTTCATGGAATTATCAAATGCAACGCCCATTGGTTTTT
CGATTGCAGCTGAGCAATGCAACAAATGCGACTTCAACCAACTCTGCATATTATGAATACACAACAGTAAATGATCTCATGATGATGACTGGGAATACAA
GACGACTAACAATAAGTTCTACCGGGAGAGTAGGCATAAGAACTGGTTCACCTTCTACAACGCTGCATGTTCAGGGACAGTATCGAGCACATTNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATTCGGGTCTCGGGCTTCTTACGACAAGTCGTGAAGTCCTTAAAGGGGATGCGGTG
TGACGCTAGAAGCACACACCGAGCAGAGCTCCGAGTTGTCAGCGTACAGCTGTTCTTTCTGAACAAGGACACGTTCGTAGATGCCCCTAGAAGTGTGGCC
GCCCACAAGGCCACGAGGAGCGACGAGAAGCTTGAAGAAGAGGTCAGCCCCAGAGCTCTCCTCGGGAGGCCAATACCCTCTTGAGTTGATGGCAGCTCCC
TGGCTGACGGGTGCCGCCACCGAGCCCCCACGCACACGCTGGTCATCTTGGAAATCTTCCTGCTGCAGGTCGAGGTCATTCGTGACCTCCCGGGGCTCAG
AGATAGCACCCTCCTCCTCATCTTCTTCCTCCTTCTCCTCCTCTTCATCCGAGGAGTCAAAGATGCTCCGATGAGAGTGTCGAGACTCCTTCTCCTCGCG
GAGTGGAGACTTAGAGGCTGTACGCTTCTTTGAGGGCTTGGCGCCTTCGGCCTTAAGAGGTCTTAGCACGCGCAAGACCCTCGGCAAGCGAGAGACGTTT
GCGAGGAATCTCTTTTTCATCGCCACCAGCTTTGGGAGTGCCCTTAGCCTTGGCGGCCGGACTCTCAGAGCGGACAGACGTGATCACCTTGATCACTTGC
GAGCGACTGCACGCTGTCGTTCTTGTGCTCACTGGGCACTGGGCTGTGCCCTCCCACAGAGCCCGCAGGAGCGTCGTGCGTGCTCTCGGACTCGACTTCG
CCCTCACCGCCACAGTCGAACTCACGTTCTACGAACCGAGGGTTCGGACGGTTGTCTGGAGAGGCCGAGGGCGACGGTCTGCGGCGCTTGCTTGCTCGCT
TGCCCACAGCCGCGTCACCCGAGGAACCGATCGCCTCGGAGGCCACCTGAGTAGCCTTCTTCAGTGCGGAGCCTTTGCCGTGAGGCTTAGTGCTCTTGGC
TTGCGCCTTTCCGGCAGCAGCCTTGGAGCGTGTCTTCGCACCGCTCTGTGCAGTGCCACGAGGCATGATAAACGGTCGAAGTGGAGACCTAAAAGAAGAG
CGCACAGATTGCTGCTCGAGGCGCTAACTGTGAAGTGAGCCTCCGCCGCGCTCGCGCGGCCAAGTCGATGGTTTTCAACTTTTAGAATGATAGTTTGTGA
CGAACACCTCTTCAATATAGAAGTGGTCGGTAAACCGAACCTAAGTGTGTGTGTGTTGGGGGGGGGGGGTAGGNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTTTTCTGGGAAGATGGTACTTACA
CATTGGTTTCTTTCTACATATTTATGTTTAATCGCTCAAGAATGAAACTCATTATTTAGTTTTCTATATATTGAGGAAATATATGTGTTCAGCAAATAAA
AAAAATATTTTGGGAGTGAGTGTGATCGGCTAAAAATGAGCCATGTGTCGCGTGATGTGTGCCGCTTCTGGAGTCGAGAAACTTTCCGCACGAAGATGGC
AGGAGTTCGAGTTTGGAGTGCGCGACATACGGGGAGAGGAACGTGTTTTCCGGGGAGAATAAGGGAGCAATTGGGAAAATGAAGCGCCCCGCCAGACAGA
CGTCCTTTGTGAACGAGAAGAAAGACGTCACTTGATCCAATCACTTGGTGATAAAACTCGTGAATCCCCCAACTTGGGCTGATCGTATTTATCGACAGAT
TTCATGTGCTGAATGCAATGCTCACCATAAATTTCTTCAATAGACTTGGTCATCGTTGGTTCAGCAACTGCAGGTTCAGCAGTCACTGGTTCAGCAACTA
CAGGTTCAGCAACTGCTGGCTGATACTTTGCGTGGTGTCGGCACCAATCGCCTTTTGAGCCGCACTGTTGGCTCGCCTTCGGGTGGTTTTCTGAGAAGAT
GTACTTACACATTGTTCTTTCTACATATTTATGTTTTATCGCTCAAGATGAACTCATTATTTAGTTTCTATATATTGAAGAATATATTTGTCAGAAATAC
AAAAAATATTTTGGAGTGATGTGATCGGCTAAAAATGAGCCATGTGTCGCGTGAATGTGTGCCGCTTCTGAGTCGAGAACTTTCCGCACGAAGATGGCAG
AGGTCGAGTTGGAGTGCGCGGTATACGGCGAAGGGACTGTGTTTCCCGTGAAGATAGCGAGCAATGCGAAAGTGAGCGCGCTGCAGAAGGCCGTTGTGAG
CGAGAAGAAAGACGTCACTTGATCCAATCACTTGATGATAAAACTCGTGAATCCCCCAACTTGGGCTGATCG