Description :
From Genome Similarity Track
Location :
Scaffold_1299:1832- 2909
Transcript NameFunction/comments
g16888.t1hypothetical protein

Sequence
1077 bases(100 bases per row)
AAACCCAGGACCAAGCAGAGCATGCTAGACAAGCGGAGGCGAAGCTTGCGAGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGC
GCAGCGAGTACGCCTGCGGTTTGAAGTCCGTGTGCGAAGCACGCGGGTGAAAACACAGGACCAAGCAGTGCATGCTAGACAAGCGGAGGCGAAGCTTGCG
AGCCGTAGCGGGCTTAGGGTTCGTACACACGGGAACCACGTGAGACGAGCGCAGCGAGTACGCCTGCGGTTTGATGTTCGTGTGCGAAGCACGCGGGTGA
AAACCCAGGACCAAACAGTGCATGGTAGACAAGCGAAGGCGAAGCTTGCGAGCTGTAGCGGGCTTAGGGTTTTGATACAAGTCTACTGTAAAATATACTG
ATATAAAACATAACCCTGTCATAGTAAAAATAGTAGTGAAGCGAGCTGGATGAGCGAGCGAACGGGCACCAACCAACCATGCCCCCACCGCCCGCAACGC
GGGCGGCGCTCGGCTAGTCTCCTACAAGTAACAGAGTAACCTGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCCGTCTGTCCGTCATTCCGTACGCACCT
CGAGCGTAACGCAAATCCGGACTTTCCGTTGGCTATAAATAGCTGCCGAGCGCAGCGAAGGCGGCCCTCCCATTCGCCAATACTATAATTCGAGCCCTCT
CATTGGCTATTTAGTGGAGCCTCTGCGCGATTGGCTATTATGATGCGTAGAGTGGACTACATTACATCGGAACTAGCCGAATGAAATCGCTGCTGATTGG
ACAAAATAAACCGCCTTTAACAACGTTTCTTTTCATTCCCATACGTGGTCGAGTTTCAGGGAGGCAAATTCTCCAGGTGGCGAAGGGCGGCTCGGCGACA
GAGACAATCGACGCATGCCTGAAGTCATCCAAACTGTGGCCACTTTTCCATACGGTGCGCCTGACAGAGAACATGCGTGTTCGCACGGCTGCCACGTCCG
ATAGTGCTGCAGAAATGGCTGCGTTTTCCGAGTACCTGCTGAAGGTTGGAGAGGGGAGACACGAGGTACACAACGAT