Description :
From Genome Similarity Track
Location :
contig_27:183172- 184208
Sequence
1036 bases(100 bases per row)
TCGACGTGTTCGACAAGTTAATGCTAAGCGTGATATGTATGAAGGCGCATCGTGGGCGACTGATGTCATCAATGGTATCACTACTGTAGCAAAGAAATCA
ACTGAATTAACCCAGACTGATATGAGTGTTGTCCTAATGGGCCTGCTCCGACAGAAGTTTAGCAAACATTGAATTATATTATTGATCAGGTTGTGGCTCA
GTCAGACTTAAAAGAAAGACTGAGTGATGAATCCTCCCAAACAAACCCTGAGGTATCAACCGATGCTGAAGTAAATATTCGTCCCGTTATGATGGATGCT
GAAGTACAGGTACGCCCCGATACAACTGATAGAGGATTTCAAGCACGTCCTGATACAGTTGAAAAGGGATTTCAAGTACGTTCCGATTCAACTGATCGAA
ACGTTCAGGCCCGCCCAACGACATCAGATGTTGGGGTTGGTGATAAGGCAACAGTCGATGATACAGATGATATTTTGCTCAGTGATGATGGCAATGATGA
AATAGATGAGCAGAAGCGATCAAAACAAGCAGTTGCAGAAATATTTGAGGTTTATCCTATTCTTGCAGATTTGGGTATTCATCCCGTCGCTGCTAATGGA
CGTCAGCTAATGAAGTATTATATTAGAAATGGAGCAAAGACATACAGTGTTAGATTGAACAAGCTTGGTTTAGTTCCAAGCATCAATTGGTCAGATACAT
ACGACCATATCGGTGTGGTACTAACTAATGACGCTCGATTTCTCAATTACATCAATGAGAAACGAGAACGTAATGAAATGGGTGAAGAGGATAAAATGGC
ACCGTTTCAAGTATGGCAGCGTATTGGATCCAAAAGAGCCAACGCTTCTTCTGGTGAGGACTATAAGCAAAGCAAACAGAGACTTGAGGATAGCTTATCT
CTTCGATCATTCAACTTCCACAACTTCCGATCAGACTTAGAACAAATTCAAAATGCACTCGATCATTGATAAAAATAAGGAACTACTTGAATCGAACAAT
TTATTATAGAAAACTGTTCCTATCCTTAAAGGAACC