Description :
From Genome Similarity Track
Location :
Scaffold_5:183125- 187284
Sequence
4159 bases(100 bases per row)
GTCGACGCACCCTTCGTAACGAAGGGCTCCACCAATTACAGGCGTCGACGTGGAGATGACGTGTCGGCTCCGGAAGCCGACGCTGCAGGCAGTGCGGATA
GTTGCAAATGTCCCGCACCGGAAAAACTTGCATGCTGTCGTGCAGCCGGGCTGCACGACGAAGCGCCGGGCGACCAAGCCGGGCTTAAAGTCGCTCGCCC
GCGGGATGAACCCGCCGGCGATACTAAGGAAACACACCCGTCCACGCCTGGGCCTGGACGAGGTCAAGAATCATGCGGAGCCGGGCTCCGCAGGACAAGA
AGACGGCGCATGCGGAGATCACTGCGCAAGTCTCGGCCGGGGGCCGAGCGCTACAAGGAATGTCTGCCGGGCAGACGGAAGCCGGACGTCGAGACGTTGA
ACGTCTTGGCGTGTACCTGTGCCTGGTTCCGGTACAGGGAATGGCTCGCTAATCCTCCGACGCAAGCGTCGGAGTTGACTTCGCTTCCAGGTATGAGCAG
GAAGCGCTTCGCGCGTGACTTGCATGATGGACGCATTGAGCAGATCTGCATTCTCTCGGATGCCGAGAGGACGAAGAGCGAGAGTGAGGAACTGAGGCAG
TTCTTCATGGAAACACCACTGAGAGCGAGGCCATCCTCAGTGCGAAGACGAACTAGGGGTGCTTTGAAGAGCAGAGCTGGGACTCGCTGAAGTCGAGTCC
CTTCTACAAGATTCTACTGGAGCTCGAGGACGTGCTTCCGGAAGAGATCCGCGCGGAGCTTCCGCAGGACAAGGGCATTCAGCACGGGATTGATCTCGTG
CCGGGCACGAAGTACTGTGTCACGCGGCAGTGGCCACTGCCGCGAGAGCAAGTCAAGGCTATCGACGCCTTCTTTGAGAGTCGTTAAAAAGCTGGACAAG
TGCGGGAATCGAAGTGCTCCGACGTTCTGTGTCAAGAAGCCACAGGGCGGCTGGCGCATCGTTCATGCGTACAACAAGCTGAACGATGCGACGATACCGG
CGCAGACCCCGATACCGCGAAAAGATGCTATCATCGATTCGATGGTCAAGAGCACTATATACAGTGCTTTTGATCTGCTTGATGGGTTCTATCAGATCTT
CATTCGTGAGAGCGATATCCCGCTCACGGCTTGTGAGCACGCCAAGCGACATGTTCTGGAAGTGGCTAGTGATGCCACAGGGTCTGAAGAAAGCCGCTGC
AACCTTCAACAGGTGCGTGAGGTACTTGTTGCGCTCGGTGCGCGACTTCGCACCGAGCTACTTCGACGAAGTGTTCGTCCACAGCCGTGCTGCGGACGGG
ATGAGCGACGTCGGGATACACAAGGTGCATCTCCGAAAGCTGCTTGCGTAAGCATAAGCTCTACGCAAACCTGAAGAAGTGTATCTTCGGGGCGAGCGAG
ATATTCGTGCTCGGGGATCTCGTTGGGAAGAATGGTGTCCGCCCTGACCCTGATCAATGATTGGCCGACGCCGTCGAACGTCAAGGAACTGCAGCAGTTC
CTTGGCTTGGCCACGTACTTATGTAAGTACGTGAAGGACTATGTGGGCACGATACGCCCGCTGTCACAGCTCCTGAAGAAGGACGCCGAGTGGGTTTGGA
CTGCTGAGTGTCAGCAGGCATTCGATGCAGTCAAGCAGGGCTTGACTGATGCGCTAATCTCGGCAGTGGCGGACCAAGATCGTCCATTCGACGTTGTATC
TGACGCATCCGACTTCGCAATCGGATGTGCGTTGATGCAGCACGATCGCGAGAGCCGTGATCGTGTCGTCTACTACCAATCGCGCCAGCTGAAGCGGGCT
GAGCGCAACTACCGGTGCATGACAAGGAACGCCTGGCCATGAAGTATGCACTCGCGAAGTTCCGAGTGTACTTACTCGGAAGCAAACCGTTCGCTGTCTA
TACGGACCTCGCGTCGCTGCGGACTGCTGTGAAGTCTCCGCACATCTCGCAACGGATGGCGAGATAGCTCTCGTTCTTCGCGGAGTATAACTTCCGGGTT
AAGTACAAACCCGAAAGGCTCAATGTAGTGGCCGACGCGATATCGCGTCGACCCGACTATGCTACGAATGATGCCGACGTCAATGCCATTGGTGCCATGC
GATCGAGTTCCCACGTCATCGTTGATGGACAACGTGAAGGCCGCGTACGCGCGCGACGCGGACACGAATCTCTTGCTGGCCTACGGCTCTTCGCCTTCTG
ACCAAGCTCGTCAGAAGCTGCCGAAACACCTTCGTGCTAGTGCACACCGCTATCGGGTGCACGATGTGTTACTACTCTACAGTGCAGTCGCCGGCAACGC
GGACCGCGTTGTCGTGCCCAATGACCATGACCTGCGACTCAGGAACATGTACGAGTATCACGATGCACCGACTGCGGGGCATCCGGGCCGTGAGAAGACA
TACCTTCTTCTTACGCGAGGCTTCTACTGGACCCACCAGTATAAATGGGTGCGCAAGTACGTCCGTGCTTGCGAGGTTTGTCAACGTGTGAAGCCTGCGC
CCTTCGCGCAGGCTCCCTTGCAGTCACTTCTAACTCCACGGGAGTGTTGGCAGTCCATGTCTTTGGATTTCGTGTTCGGTCTTCCCCCGGACAGCCAGGG
GGTACGGGCGTTGTAGTCTTTGTTGACCGCTTCAGCAAGATGGTACATCTTGCTGCGGTACCCGCTGAAGTGACTGCGAAACAGACGGCGCGTCTGTTCG
TTGACATGGTGTTCAAACACCATGGCATGCCGATCGACATTGTGTCGGATCGAGACCCGCGCTTCACTGCGCACCTTTGGCAAGAAGGGTTTACACTTCT
GGGGAGTCAACTTTCGATGTCGACTGCAGACCATCCGCAGACGGACGGGCAGACCAAGCGCGTGAACTGCGTGCTCGTAGACGTGCTTAAGAGCTACGCT
CACTCGTTCCAACACTGGAGCGAGTGCCTGCCGACGGCGGAGTTCGCCATCAACAACTCGGTGCATGCCTCGACCGGGCATACACCCTTCTACGTGAATG
CCATGAGGCACTCAAGCCTCCCGAGTCTACTCGGGATGGTGGCTCCTTCCTTGAGTGGGGGAGGAGCTCCGACTGCACCGCAGCAACCGCAAAATGCCGC
TGACACTTGCATAGTGTCAGCCGCGACCACGCTCAAGAAGAAGAACGCGTCTGTGTAGGGCACAGACGCCGACAAGCGCACGAAGAACGTGTCTGTGCGG
GGCACAGACACCAACAAGAAGAAGAAGAGCGTGTCTGTGCAGGGCACAGATACCACGAAGACCAACGCAGAGGCAGGGCCTACTGCTGGAAGCGAGAAGA
ACGAGTTCAGCTAGGACACAATTACATTCGTGCAGCGAAGACAAGCCGTCATTCGGTTTGTCCAAGACACTATTGAAGCTTCTGGCGACCGGCAGAAGCT
GAATGCAGACAATGTTGGCAGGGGCAACACTAATGAATTCGAGAAGGGTTCATTAGTCTTGTTAGCTACTTAAAACTTACCTAAACATGTAGTGTCCGGC
TTAGGAGCAAGCAAGCTTGCTCCGCGCTTCATCGGTCCGTACGGCAACGCCTACACTATGAACATACCGTCTAGTATGCGCCTTCATCCGACGTTCTACG
TCGGACGGCTGAAGCCATACCTGCAGCATGAGCTACCTAGCTCGGCTGAACCGAAGCAGAAGATTCGGTGGAAGCCATCATCCCCTTCAGCGCGAAGTCA
CGCTGGAGCGGCAGGTCCAGCTGGAGGTCCAGCCCGGCCGGGACGATCGAGGCAGTCTGGGAGACCGTCGCAAAGTAAGGAAGCTCCAGAGCGCCGAACG
CAGCGCTCTGTAACTGCTCCACGACCGGAACTCGGTCGTGGGGAGACGCGAGATCAGAGTCAACACCAAGTTGACCACACACGGGGCGTGTTTCCACCAC
CACCGCCACCAATTCGTGACGCACACGACTCAACTCAATGGATAGTTGGGCGTATTGTTGGTCACAGAATCCCGAGAACGAACAGGCAACCGGTTCGTTT
TCGTATCCGTTGGAGAGGATTCCCTCCCGACCAGAATACATGGGAGGCGCGGAACGTCTTGCTCGAAGACGTTCCGTACATGGTGAGGGCGTACGAAGCC
CACCATGCGCTACACATTGGAAAGTAATGCGAACACTGTTGTTAACAACAGCGCCCGAA