Description :
From Genome Similarity Track
Location :
Scaffold_8:183122- 186948
Sequence
3826 bases(100 bases per row)
GTCCGGAGAGGGAGTAAAATCTCCAGAGCTCCTTGCACGACGCACCCAATCCCGCGCGGTCTCTACTACACACCGTTATGAGCCGCAACCAGTCGCCAGT
AATCGCCTGCTTGCGCTGCCGCCAGGACACGTGCACGAACGTCTTCAGAGTACGTTTTACCCATCTTGGAAATTGCAAAGTGTGGAAAGCGGTGAAAGGG
CGACATTGAGTTCTCGAAAGTTCTCGAAGTGGTAGGAAGCTAAAAAAAAGGACAAAAGTTGATCCGTACCTAAGCGGTATCAGAAAAAAAGACATTCTGG
TTTTTTTAATACGGCTGGTGGTAAATTTAAACTGAGGCCTGACCAGCCCTATGCACAGGTCGGCCGGGAGGTGGTTGTATTGAATCCGTCCTCTGGGGAG
AGCGGACCTGAAATGGTGTACATGTATTGGAGCTTACACCCGGGCATCATGGTGGCATACTGGTCGAGTCATGCAGATTGGATTGCAGAGAGACCCTACG
GCGTCTCGGGAGGAGCTTAACCCCAACAACAAAAAATTAAAGATATTAAAGAAGACCAAAAGTTGATGACCTTGATCAAAACTGAGGCCCTCAGTTCTGT
TAGATGCCCCTTTGAATGTGTATGGAGATGTATCCCTGTATAGCTCTCTACAACCATACTAGCAGCTCTTCGCTAAGCCTACGCGCTATTGCATGAACTG
CTGTGCCGTAAGATGTCCGGAATGACTTCCCGGAGAGTGTGCACTTCACTTAAGGACAAAAGTCGTCAAATTTGATCGTTTAATCAAGTAGTAGTACAGT
TTTAATTCCATACAAAATGGCGTCGGGTACTAATCAGACAGAGGCAATTGCTCTTGCCGCGCTCGATTTTTTTCCTGGTCTTAAGAGCAAAATCACGCGG
AATTTGACAATCTTGCATCGTTTTTCGTCCTCATTCTTAGCTTTTATAAAACTTAGTTATTCTAAAACGCAGCAATTTCTTCTAGTCAAGTCTAAAAAGC
ATAATATTTACCTTTCTTAAATAAACCCTCTCTATTCCCATACTTTAAAAGTTTCATAAGCCTCTCAAAGAATATCCCATCTCGCATTTTAAAATGTCAT
AAAGGTGAAGATAAAGTGTGGTTCTGTTGGTGTGACGATAACATCTTTTGTCATGAGCGTCGACACGAGTCTTTCGGTGGATGAGCTTCTGCCACGATTA
AAACGCTACAAGAATCCGAGTTGGTGGATACAAATGCCAGCAGGCGGAGGCTTTATCTAGCGACGAAAAATTCTAGAGATACCGTAAAAGTGTAGACTCT
AAGTGTGGTTTCCGGTATGCCGAAATGTGGGATCGGTAATTCGATCTGAGACATGTATTTCAAATATTCAAAGAAATCGAATTTATAAAAATTTGAGTGC
CATTCATTTGTAAGAAGGATTCGCGTGGGGAAGAGTGAATGGTACGGAAACTTGTTCCGTTTGTTTGACTGCCTATACTGACGTGTGACGTGCTGGGGCT
ATACGGCAGAGTGAACGCGAAGAAGATCCCGATGGGCAGGTGGAGCGGGGTCACATCCTTCTCCAAGGTCGAGATCGTCTATTAAACCTTCGCGCTAGCC
GCGAGAACCTCGAGAGAACCAGAGAGCTGCCAAATTCTCAGCCGCTCCGGCAAGCGACGCAATCTGCTGCGATAAAGCTAGTGGAGGAAGTTCTGAACGA
AGAGGCCGTGAAGGCTCAGGTACAGCAAATGCGTGCGGAGTACGCAGCAAAGCACGGGCCTTCGAAAATGATGCCAAGGGAGCGGGCTACGGCACCACCG
CAACGTCATAGGAATCGCATTAGCCAGCGCGTTTGCCGACAAGGACGTTTCTCCGAGAATGAGGTGGTGGAAGAAGATGAAGAAACGCGGCTACAAAAAT
CATGTCGTTCGCCAGTTGATGATGTAGCTGCAGCGCGACAGTTTTTCGAGCTGAGTGGCTCGTCATCAGACGAAAGCTCGCCCGTACCTTTTGTCGCCAC
ACAATTGCCGCTACTTGGAAGCGAACTGAAGTATCTGACGGATAATACGGTGCTGGAAGCCCCAGATCGGGCCCAATTTGAGAAATCTAAAGACTCACAA
TTCGAGAAACCCGATGAAGCACAGTTCGGGATACGTGAAAGCGCGCACTTCGGGATACCTGATAGCAAACATTTCGAGAATTCAGATGACGTCAATTTGG
ATATACCGGAAAACTACGGCAACTGCAGCGACGGTGTTTTGAACGGCTTCCCTTCGAGGTGGAGCTCTTGGAAACAATTTCATGACGGACTTAAATCGTT
TAGTGCCCAGACCAACCAGTGTTTTATTATTCGATCGTCACAGACCGTGAAAAAAAGGAATATGCAGATGAATGACGGTATTCGACACTTTCCAATTGCA
TGGAAGCATTACTTCAAAACGCTAGTGTGTACGCACGGACACAAGCAACGACCACGCGGCAAAGGAATCCGAGTCCACAGATCGGTGCGCTACACAGGTT
GTACCGCGAAGGTACACGCTCTGTTATCGAGTATGGGAACACGACACTACATTTACGTTCGCAGTTCTGGCACTCACAACCACAACCTGAGTAGCATGCT
ATGGGACTATTACGCAGCCAATCGAACAATTCAAGATCCCGCGCTACTCGCCACAGTTTCTGACATGCGCGCTGCTGGTTCCTCGCCTAAAGGCATTCTT
GCTTGGATCCGCAAACAGACAGGTTATCTACGTAGAGGCTGACTAATTCCACAAATTACTTAATGCTTTTGTGTGTGATTTTATTTACATATAGGGAAGA
AAACGAAGCTCAAAGATGTGCATAACATGCTGCAGGAGCTTAAACATGCAGCAAAGGGATCAACTACAGACGTTGAAAGAACCGAAAGCGTGCTACGTGA
GTTTACCAAGCAGGACGAGGGGAACACGGCAAAGATATTCGTGGACACCACCAGAGAGGTGGCTGTAGCGGTGGTCTTTCAATCGTCTGGGATGAAAAGA
CTTTTCGAAGCTTTTCCTGAAGTTGTAATGGTAGATACAACTCACGACACAAACACGAACGCATACAAGCTTTTCAGCTTTGTTGTGCATGACTGTTTTG
GAAAGGTACACTAGTAATGTTTATATGGAATCATTTCGACAGTTAACGAACCTATTTGATGTTTGCGTAGGGTCAGTACGTTCAACACGCATTGGTTGAA
CGGGAAACCAAAGAAAATCTCCGTCTGGTTCTCCATACATTCAGAAAGAACAATCCCGGCTACAAAAACGTGAAAGTACTTATGACAGATAAAGCTTTCC
ACGAGAAGGAGGTTCTAGCTGAGGTTTTCGAGGGAACTCGTCAACTACTTTGTCAGTTTCACGTGCAGCAGTGGTTCGCTAAGCAAGTGGGGAAGTTAGT
TGTTGGAACTACGGAGACAAAGGCTATAATTGAGGCGTCTATGGCTCAATTGATAGACGCCGCGAGTACCAGCGAGTACGATAACCAGAGAGCTTTCCTT
CTGGACCTACTTGGAGGAGACACGCAACACAGGCTGTGGAAATTGTTCATTAACAACTGGGATAACATGCAAGAGCAGTGGGTCCGATATAAGCGTGGTA
ACATACCCCACCTTCGAAACAACACCAACAATCGGCTTGAATCAAAGTGGGGAAAGCTCAAACAGTTGATCAGATCGGACTACGGGATTGATGAGTTGGT
ATCCGCGCTTATAATGATACAAGAATTGGCCGAAGACGAATACGTGGAGGAGTACAATAAGGCAGGGTCAAGACCTCCAATGGACGAGCATCAGGAGCTG
GCTCATCTTGGCGTCGTTGTAAGCTC