Description :
From Genome Similarity Track
Location :
Scaffold_1630:1831- 4152
Sequence
2321 bases(100 bases per row)
AGGCGGATCCACCAAGGGGCCAGTTGGTTCCGCCGGGAGCTCCCCTTCCCCGAGGGATTCGATCGCGGTAGTCGCCTCATACGCCAGATCCTGCCATTCG
CTATAGCGACGGGATCCCACTGACACATATCCAGGTCGCCTAGGGATACCATCCTTCGTCAACCATCGCCCAATCTCCTCATAATGGTCCAGTAATAGTC
TCTTGTCGGTAACATTCGTGACCTGGAGGTATTGTGACCGACCTGGTCCTTGGATTACTGTAGGCATTCACTTCGCACCCCGAGTGACCCACAGTTTCTC
ATATTCCACCCATTTCAACCGATCTGACAGTCCCAGGTTTATCCTGGCTCAATCCAGGTCATCTTATCCGCCCTTATGGTCATCATATTCGCCCGTACAA
CGGCCGCCGTCCGCTGAGCTGGATCCGCATCTCGTCCGGGAAACACAGTGTCCCATCCGCCAGATCTAACCTTACTCCGGCTGGTACCATGAAATCCATC
CCGAGGATGGCGTCTTGACCAGCGAGATCTCCAACCCAAATATCGAACCAGTATACCAAACAACCAGCCAGCGTGATCTTGATCCGCGTTCTCCCATTCG
TACGGTACACGCCTTCACCAATCCCAACACAATCTTGGATCCGACTCCCATCCACTTGGCACCCAACCTTACGAGCAAAGGCGGTATCTAGTATAGACGC
CTCGGCACCACTATCTAGGAGTAGGATTGCTTTTTCATTGTTGATCTTGCCCCCTACCTTGGCTTGTCTGAACCATTTTCCTGGGGCATGATACTTCCAG
TATCCACGGGACTCCCCTGTCAGCAGATCCATGGATCCACTCTCTTCAGACCCACGGGATCCAGTGACCTGACAGACCTTAGGTGGATCTGCAGTGACCT
CACCCTTGGTAGGCTCAAACAATCGACTATGCTGTCGTTTCTCCCAGTAACCGCGCGCTTCTCCCCTTTGTAGATCCAGGGTTGAAGAGACCTCGAATAT
GGCAAATTCATCCACTTGGCGCAAACTAGAAATCTTGGCAACTGACACTTCATGTAGATCACGTGTATTATCGACTGGATCTAGGGTCCTGCTACCTGGA
TCTAGCGATGTCTTGTTCACAAATGCATAAATGCAGTACCTAGAACGCTCGGCTCGTACCGGATTCAAACCCGGCGAGCGTCCTAGTTTAACATCTTCTC
GGCCACTTCTGGCAACATCCCTCTGTGCTTGGCAGGATCAAACCTTTGGCGGATCTGGTTGTAGAATTCTTCCATCGGACACTTGCCGACGTCATGAATC
TCGCCACAACTGCGACACACGTAGAAGCAATGATCTCCGGGATGACCCTTCTTGCCACACTTCTCACAGACCAGATGTTTCCAGCATCCAGATTCGGTGT
GCTTTTGGGATCCGCACTGCGAACACCTGACTTGTGCTGTCCCGTCCATGAAATCTCGGGATCTGTACATCCCACGGTCCCCGGGTACGGTATCCCTCGG
TCGAGAGTTGTCTCCGGTCTTCGCCTTTCGATCGTTGGACGCAGTGAGACAGACTTGACGGTAATCTTCAGGGTCGGAGTCCGAACCGTCGGATCCTGAC
TCAGTTCCTGAGTCAGGCGCCGTGACTTGGTGGACACGTCGAGCTGGGGCCGTGGGCGTCGGAGCCTTTTGGCGATACTTGCCGGATCCGACCGCCGCCT
TCTTCTGGCGTTGTTTCGCACGATCCACAGCCCGCAGCACTTCTTCGAGTTCATCTGCGTCTGGAAGGCGTAACAGGGTAAGCCTGTCGGCCAGATCCGC
ATCTCCCAACGTCTCAATAAAATGATCCACGTGTTCCCGCAGTACCTTGGATCCCCCATCCTTGATCTTCAACTTGGCCCGTAGACCGGCCACATTTAGT
CGATGTAGGTATTCTAGCGGGGATTCATCCGATCTGCGGCGAGCATGGTAGTATTGTCGTGCCACCGACACTCCCAATCCACAGTACTCGGTCTGGAAAT
TGCGCAGCTGATCTGGCCACTTGTTCCTGGTGGATCTGCCCAGCTGCCGATACCAGTTTCTGGCTGGGCCGCTAGCAGATCCGCAAAGGTCAAACGCTTC
TCAGCATCCGACGCTTGATCTCTCATGAGGGCCGACTTGACTTTGCTGATCCATGTTCGCGCTCGGTCCTCATCTTGATCCATGCCCGTGAACTCCTTCA
GATCCGATATGGCTGAGATCCGTACCCTCTGGATCATGTACGATCCTCCTGCCCCGGCTGTGGCTGTTGCTACCACTGCTGACGAAGTGGATGGGCCATC
CAGATCATCTGGGTCGAACTC