Description :
From Genome Similarity Track
Location :
Scaffold_399:18308- 20942
Transcript NameFunction/comments
Pytul_var.sporangiiferummaker-pug3_contig_399-snap-gene-0.15Conserved gene of unknown function

Sequence
2634 bases(100 bases per row)
ACAAGGAGTACACGTTTGCGACGCAGTTCACGGATCCGAACAAGCAGAAACAGCAATTCTGTCTGCAATGCTGTACGAAACCCGTGCCTCTGACCGGTGC
CGATGAGACATGGAATCTGTCGTGTCCACTCAATGACCTGCAACGGTTAAGCGTGAGCCAAGATCGCCGCGTATTTCGATTCGCGCGCCGCAACACGCTG
TCGGACGAGACGATTATCGAATGCCCCATGCCAAATCGCACGCAGTCGACATACCTGAGTGGGTATGCACTCACCCTGTTCATCATTGAGCGCACCGCGT
CCTTCGGTGCGAGCTATTGGCGGAGTGTCGTCAATTGCTCAGTCCAGATCTCTGAAAGCACAAAGCTGCCGGTCACATTCAGTGAGGTGATCCGCATCCG
ATCAGTCCCGACGCCGCAAACGCGTCCCACAGCATGGGTAACGCCAGCAGTGCTCTGTGTCGTTGCCGTTGCTGTCGTCATGAGTGTCCCGATCTACAAA
GGACGCATCCACGGACAGCGGTGTCTTCATTGTGGCTCGTGGCTCGTGTACTGGAATCACATGTGCTGGATCTGTATCTGTATCAGCTGCAAACTGCATC
CACTGCCCGCAAAGATCTACGTGGACAATGGAAAACCTCACGATGGGAAAACGGATGTGAGCGATTCATGAGAAGGCTGACAAGTTGTATTTAATTCCTC
CTGTTCACTTATTCTCCTTTGTGAGCGATTCGATTAACTCAGCGGCTTTCGCCAGAGAAAAAAAGGTCGATTCTTGTGGGGCTTAACGGATTCTCCGCGC
TTTCGAGGTCGGCGTTGCGTCGATTTGGTCCAAATCCGGCAACAAGGCTTCCAGTCGCTTCCGATACTCGAAATCCTTTGCGAGTGGGTTGCGCTCCAAG
TACAGCGTGCGAAGCTTCTTGAGGGGTACCAAATGGTTCGTTTCACTGAACGCTTCCACTTGGTTGTCATTGAGCCACAGGTCCTCGAGCTCCGTCAGAC
CCTGAATATCCTCCGGAATGGCCGTGATTCGATTCGCACCAACATCCATCACTGTCAAGTTTTTCTGCACATGCAATAAATAGTGAGCCACAGTATGCAA
TAAAAATACCGCAGCGAGAAGTTCGAGACACCAAGCCACTTACCAAATGCGCGACGCCCTCGAGTGCCGTGATGCCGTTGTGGCTCAAGTAAAGTTCTTC
CAACGCCAGCGTGTTCTCAAACCCTTCGATCTTCTCCAGTCGATTACTCTACTCATACATGAATAGTATGCGACCAACAACCATCAGTCAGCATTTCCTA
AGGAAGAAAAAAAGCAAAAGCGCAGCATCTTACCTGGACGCTGATGATTCGAAGCTTCTTGAGAAAGTCCAAGCCCTGGATCTTCGTGATCTTGTTTTTA
CCCAACCAGAGCTGCTCGAGGTTCTCGAGGCCTTCGAGTCCCTCAATATCGCGCAGACGGTTGGCGCCCAGGTCCAGTTTCTTGAGCGTCGTCAAGTGCG
TGAGCCCCGAGATCTTCTTGAGCTTGTTGTTGGCGACGTAGAGCTCTTCCAGCTTGGTCAAGTGGCTCAGATCCGGGATCACGCGGATCTCATTGAAGGA
CAAGTCGAGCACGCGCAAGTTCACGAGCCTATCGAGGCCCGAGATCTTCTGGATCTGGTTGTCGTACAACTCGAGATGCTCCATTTGCACGAGCGATGCG
ATGCCGTCCATGGATTTTAGCAGGTTCGAGCGAAGATGCAGACGCTAGTTTGCAAACAACAGGATTAGTAAAGTGAGCACACCATGATGCGCAATATATA
CATATATTCAGCCGCTAGCGCTTCGATAGAACCATACGCTTTGTTGTCCTTTACACATACCTCTAGCTTGGGCATATCTTCCAGTCCGTTGATCTCCGTG
GCCTTCAGACCTGATGTGCCCACATAGTACACGTCCTATTATCCCACCAGCACACACACACACATACATATAACAGCCAACAACACCATCCATCCACACA
ATGTCATTGAGTGTCTCACTCCACAAAACAGTACAGTGTGCTATTGCGATAGGAAAGAAGCGCACGCACCTCGGCGTCTCGGTCAAACTCGACGCATTCG
GTGAGTTTGTTGACGACTGGCGGCGCTTCTTCGTGCTCCCCGTCATCGTTGTGGACGTCGCCAGTGGCTCCAGAGGCTGGTACAATCGCTTGCTGCTGGT
TGGTGACCACGCGCGCGGTCTTCGGGGCGCTCGCGGGCGCGTCGCTGCCTGCGCTCATGTTGCTGCTGCTGTTCATTTTGCGCTTCTCTCTTGACAAAGT
GGGCATACATGTTGCCGTACCTGCCCTAGTTTAACGTGCGAATTGGCACGTAATGTTAGTACAAAGTGATATGTCACTTTGTGATATAGTGTGGTAGAAA
TACATTGTACACCAAGTTGGGAAGTGTAGCTCTATGTGAAGAGAGCCATTTTCGCTTGTGTGCTACTGAGAAAAAGGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCAGGTAGGCGTCCTGCATGCGTGTGTGTGGGCTATGCG
TTTGTGCGGCTGCGCATTGCCTCTTCAACCCTGT