Description :
From Genome Similarity Track
Location :
Scaffold_3:1830530- 1834684
Transcript NameFunction/comments
Physo_256351SCP-like extracellular protein
Physo_410820SCP-like extracellular protein

Sequence
4154 bases(100 bases per row)
CGTGCCAGCCGCTGGCACGTGCAAGCAGACTTTCCCCGCGCTATCGTTTGGGTGGTGTCGGCGGCAACCAACAAGCAGTATTGATACCTTTTGTTACTGG
CAGTGTCCGGTGTCCGAACATTCGGTACCGGAGATCGTCGAGTAATTTGGTAATGCGAGCCAAATGCATAGGGCCAAAATTTGTGCCTGTTCAGAAGCCA
CCCCACGATAACGACGAGCAACAACCCACCCACAGCATACTTAAGTAGCATCAGAATGCGTTGGGTGTTTTGGGCAGACCTTTTATGCCGATGCGGCGCA
GAAAGACCCAATTTGGTGAGGCGACACAGATCTGGAGCAGCTGTAGATTTGTGAACCGCGCGTCGCTGGCCAGCAGGTGGCACAAAACAACAATGCAACA
CCCGACACGGAGATTTCGCGTCTTCGCGCACAGTCGTTCAGGTCGCTGACCTCACCTTCCGAGTGTGAGCCCAACTGTTCGCCCAATCTGCGCCGCCCGA
GCCCGAGGGTGGCCCGTTGCAATCTTCCGCAGCGGCACCTGGGCTCCGTCTCGTGGCCGCAATGCCTTGTCGACCGAACAAACCGGTCGGGTCGGTGTGC
AATGTTGGCGTCGCAATGTGCGACCGAAGCAAGGGGCACTTTGGCCCGGCGACGCCCTTCCAAGCAAACATCAGGTCACGACGCTGGTCCGGAGCTCTGC
TCGACGAGCAGTGCTCGTCACCGAAGCATCGACTGCTAACACCCTCTTTGCTCAGCGCCCAGTTCTCAATTTACTCCTTCGGCCGACATCAGCGTAACCA
GCTCAACTCACTCAACTACCGTAGAACAATGGCCATTTCTCAGTCCTCGCTTGCTCTTCTGCTCATTGTGGCGGCCGCCTCCAACGGCCTTTCCGATGCC
TCTTACCTCCGCAACCTGGGCGGCACCACCATCGCCACCAACGTCAAGACGTACACGGCGTACGGCGACTACGCGTCCGCCATGCTGGCGGCCGTGAACA
AGCAGCGCGCCACGGGCGGCCTCAAGCCCCTGTGCCTCAACAAGAAGCTGCACGCCGCCGCGCAGCGCCACTCGGACGACATGGCCGCCAAGGACTTCAT
GGCCCACGACGGCTCGGACGGCTCGACCATGTCGGAGCGCATCACGCAGGCCAGCTACGACTGGGAGAGTGTGGCCGAGAACGTGGCCGCCGGCCAGATC
GACGTGGCCGACGTGATGGTGGCGTGGATCAACTCGCCGGAGCACCTGGAGAACATCATGGGCGACTACACGATGTTCGGCTCTGCGTACGCGTTCAACA
AGGACGGCACGTACCAGCACTACTGGACGCAGGACTTCGGCTCGGGCGACGCGGAGCAGTGCGACGGCGCCCCGGTGGCGCAGAAGACGCCTGTGACGCC
CGCGCCGACGACGGAGGCCCCTACGCCGGCCCCGACGACGCCTGTGCAACAGGAGATCCCGGCCACGCCGGCCCCGACCACCGGCGAGGAGGTGCAGGGT
GAGGCCGAGATCCCCCAGCAGCAGGAGGTTGTGACCCCCGCCCCGACGACCCCGACTGAGGAGAGCCCTGCCCAGAAGGACTGCGAGTCCAACTTCTAAG
TGGCTAAGGCGCGTTCTTAAGTTCCCGGGAGCTGGGACCGGGACGAACGGGACGATACCCCTCGTACGTCAAACTTGATAATTGTAAGCATTTTTTAAGC
CCCTAACTCTCGGTAACTACCGCGAACTACGGTGAAAGAAGAACATGGTCAGATAGCCCTTTCGAAACGTAACAAAGTGGTGCACACTTGGCGCGCATTA
GTGAAGAAATGAAGTAGCTAAGGTCTTCTGCCAGTTTCGTGCCGTCCTTCGAACTTGCGGACTTGCTGTGGCATAACTTTTCATTGAATTGTCCATTCTG
AAATCTGATTGCACCCGCTAAATCTGCGCGATTGGGCTGAATTTATGACTTCACGCTGGTCCGTGTAAACTTTGCAGAACTTCTTGTTATTGTTTTGAAA
AGCTTGTTGATTTGGAGTGAGCTGCCAGTTTCCTGCCTCTTTTTGATAGCATGTTTGTATGCTATGCAAATCCTAGAGGCTCATCACCGGAAATTGCATG
TGACGCTGGAAAAATCTACCAATAGACTACGAGAGTTTAACAAGGAGAAGATGCTAATTGGCTAAAACAAGTAGGCACGGAACTGGTTGTAGGCACGCAA
CTGGCGCCTTACCTTAGGGCGAAAGTCCCACGTCCCGACCACGCGAAAATGATGCGGGACCGGGACAAAATGAGCTCGGAAATAAACCTAGCCCGCTTCT
GAAAGCCAATCAAATCGCTCTATTTCGTCCCGGGACTTGGGACCGGGAACTTAAGAACGGCCCTAATCTACTTTCTGTAATTGAGCTAGCCCCATGCGGG
TATATGAAGTAAATGGACAGGTGCTCAGCGGTACTAATACATAGGTGTGAAACCCAAATAGACGCTTTCATGAATAACCCACGTAACGGTGGCGTATCGC
CCTCATCGTGACGACGTTCATGTCGATGTAGCATTCGCGCAGCGAAACATTGAGGCTTCTCCGATCGACGGGCGTCGCGCTCGATTTGGCGAGGTGGACC
GTTAGGTATCTTGTCTTGCCATGTTCAAGCGTGCTGGTTAGCGCTACATTGCTCCACCAGCCTATCCATCCAATATTTATTGTGCGCTGGCAACGTCTTT
CTGTTAGGCCACAGTGCTCTATACATGTAGCGCGCGAAAGGGTTCTGGTTTAGCGCTCCAGGAGCAAGAAGCAATCCCCACAGTTTGGGTTTACACCAGC
GAGTGTGGCATGTATAATAGCGACCAGTTTCCCTTTCCATCCCACGATGGTGATCCCGTGCATTGCCATGCAAATTGAAGCAATTCCTCGCGCCAGAGCA
TCCTCTCGCCTTGAGGAGAGCAGGCCTCGTCCACAATCCGGACGGCGCTGGCAACGCGCTGCAATCCTGGTCCACAGTTCGCAATTTTTCCCCTTGGAAG
CAGCAGTGCCCACTCCAGCCCGCCCACTTCAGCCGCTTGAAGATGCTTTCTGTGCCCCAGTACTCGCTCGCCCTCCTGTTGATCGCCGCCGCGGCCTCCA
GCAGCATCTCCGAGGCGGCCCCCACCGGTGACTACTTTGCGGCCATGCTCGCTCGTGTCAACAAGGAGCGCGCGGCCAACGGAGTCTCGAAGCTCTGCAT
GAACAAGAAGCTGCAGGCCGCGGCTCAGCGCCACTCGAACGACATGGCCAAGAACAACTACATGGCTCACGACGGTGCGGACGGCTCTACGATGTCGCAA
CGCGTGACCCAGGCCGGCTACGAATGGGAGAGCGTCGCCGAGAACGTCGCGGCCGGCCAGGAGGACGTCGAGTCCGTCATGAACGAGTGGATGCAGTCTA
CGGGCCACCGAGAAAACATCTTGTGCGCCGACTACACCATGTTCGGCACGGCGTACGCGTACAGCAAGGACTCCACGTACGGCTACTACTGGACGCAGGA
CTTCGGCAGCGGTCCGACGGAGTCGTGCGATGGTGGCAACTCGAGCACTCCAGCGACTCCGGCCCCTGCGACAGAGGCGCCTGTGGTGACTCCGGCCCCG
ACGACCGTGGCTCCGGCCACTGAGGCACCGGTGACCCCCGCACCGACGACGGTGGCTCCGGCCACTGAGGCACCGGTGACCCCCGCACCGACGACGGTGG
CTCCGGCGACTGAGGCCCCGGTGACCCCTGGACCGACCACGCCTGCTGCGGAGATTCCGGCCACCAAGGGCCCCGTTGTTACGACTCCTCCCGCTCCGAT
CGCTACGCCTGCCGTGACGACGCCGGCTCCGATTGCTACGCCCGCCGCGACGACGCCGGCTCCGGCCACGCCGTCGACTTCCCAGAAGGACTGCGAATCG
AACTTCTAAAGGTCTTGATATTGTTCATAAGCAAACGACGCAGCGTGGGTTGGAATGAGGAGGCGATAGACAGCTTCCACAGTCAAACGCATCAGTCAAT
GCACAAGTAAAATCCGAGAAATGAAAAGCAGAGCATTAGATACTGCGATTTCCCTGCACATGTTTTGGTAACCAGATTTCTCGGTGCGGCATTAACATAC
TTTCATAGCGTCCGTTTGCGACGTTATGCTGTTCGTAGCGATTAAAGATTAAAG